ID: 1042445955

View in Genome Browser
Species Human (GRCh38)
Location 8:68885191-68885213
Sequence AATTCTAGGCAGAAGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042445955_1042445966 24 Left 1042445955 8:68885191-68885213 CCTGCCCTCTTCTGCCTAGAATT No data
Right 1042445966 8:68885238-68885260 AAGGCAGGACTCCGAGGCAATGG No data
1042445955_1042445959 5 Left 1042445955 8:68885191-68885213 CCTGCCCTCTTCTGCCTAGAATT No data
Right 1042445959 8:68885219-68885241 GCCCCCTGTTTCTATCAATAAGG No data
1042445955_1042445964 9 Left 1042445955 8:68885191-68885213 CCTGCCCTCTTCTGCCTAGAATT No data
Right 1042445964 8:68885223-68885245 CCTGTTTCTATCAATAAGGCAGG No data
1042445955_1042445965 18 Left 1042445955 8:68885191-68885213 CCTGCCCTCTTCTGCCTAGAATT No data
Right 1042445965 8:68885232-68885254 ATCAATAAGGCAGGACTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042445955 Original CRISPR AATTCTAGGCAGAAGAGGGC AGG (reversed) Intergenic
No off target data available for this crispr