ID: 1042446917

View in Genome Browser
Species Human (GRCh38)
Location 8:68895339-68895361
Sequence CTTAAGGACGTTCCTGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042446913_1042446917 26 Left 1042446913 8:68895290-68895312 CCGCTTAAGGTGTTCTTAAACCA No data
Right 1042446917 8:68895339-68895361 CTTAAGGACGTTCCTGCTACAGG No data
1042446914_1042446917 6 Left 1042446914 8:68895310-68895332 CCACAAACAACAACTTGAGTGAT No data
Right 1042446917 8:68895339-68895361 CTTAAGGACGTTCCTGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042446917 Original CRISPR CTTAAGGACGTTCCTGCTAC AGG Intergenic
No off target data available for this crispr