ID: 1042449119

View in Genome Browser
Species Human (GRCh38)
Location 8:68923669-68923691
Sequence CTGTGTTACCAAAGTGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042449119_1042449121 3 Left 1042449119 8:68923669-68923691 CCCAGTTCACTTTGGTAACACAG No data
Right 1042449121 8:68923695-68923717 GCAGTCATACCTGAGATCTATGG No data
1042449119_1042449122 4 Left 1042449119 8:68923669-68923691 CCCAGTTCACTTTGGTAACACAG No data
Right 1042449122 8:68923696-68923718 CAGTCATACCTGAGATCTATGGG No data
1042449119_1042449124 21 Left 1042449119 8:68923669-68923691 CCCAGTTCACTTTGGTAACACAG No data
Right 1042449124 8:68923713-68923735 TATGGGTTTAAACCCAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042449119 Original CRISPR CTGTGTTACCAAAGTGAACT GGG (reversed) Intergenic
No off target data available for this crispr