ID: 1042449972

View in Genome Browser
Species Human (GRCh38)
Location 8:68932818-68932840
Sequence AATCAATTGGTTTGGCTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042449972_1042449976 2 Left 1042449972 8:68932818-68932840 CCAATGAGCCAAACCAATTGATT No data
Right 1042449976 8:68932843-68932865 CTTTGTATCATCGATGCAACGGG No data
1042449972_1042449979 29 Left 1042449972 8:68932818-68932840 CCAATGAGCCAAACCAATTGATT No data
Right 1042449979 8:68932870-68932892 CATTGAAGCGATTTTAGAAAGGG No data
1042449972_1042449975 1 Left 1042449972 8:68932818-68932840 CCAATGAGCCAAACCAATTGATT No data
Right 1042449975 8:68932842-68932864 ACTTTGTATCATCGATGCAACGG No data
1042449972_1042449978 28 Left 1042449972 8:68932818-68932840 CCAATGAGCCAAACCAATTGATT No data
Right 1042449978 8:68932869-68932891 CCATTGAAGCGATTTTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042449972 Original CRISPR AATCAATTGGTTTGGCTCAT TGG (reversed) Intergenic