ID: 1042449973

View in Genome Browser
Species Human (GRCh38)
Location 8:68932826-68932848
Sequence ACAAAGTAAATCAATTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042449973_1042449976 -6 Left 1042449973 8:68932826-68932848 CCAAACCAATTGATTTACTTTGT No data
Right 1042449976 8:68932843-68932865 CTTTGTATCATCGATGCAACGGG No data
1042449973_1042449975 -7 Left 1042449973 8:68932826-68932848 CCAAACCAATTGATTTACTTTGT No data
Right 1042449975 8:68932842-68932864 ACTTTGTATCATCGATGCAACGG No data
1042449973_1042449979 21 Left 1042449973 8:68932826-68932848 CCAAACCAATTGATTTACTTTGT No data
Right 1042449979 8:68932870-68932892 CATTGAAGCGATTTTAGAAAGGG No data
1042449973_1042449980 26 Left 1042449973 8:68932826-68932848 CCAAACCAATTGATTTACTTTGT No data
Right 1042449980 8:68932875-68932897 AAGCGATTTTAGAAAGGGAGTGG No data
1042449973_1042449978 20 Left 1042449973 8:68932826-68932848 CCAAACCAATTGATTTACTTTGT No data
Right 1042449978 8:68932869-68932891 CCATTGAAGCGATTTTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042449973 Original CRISPR ACAAAGTAAATCAATTGGTT TGG (reversed) Intergenic