ID: 1042449974 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:68932831-68932853 |
| Sequence | ATGATACAAAGTAAATCAAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1042449974_1042449979 | 16 | Left | 1042449974 | 8:68932831-68932853 | CCAATTGATTTACTTTGTATCAT | No data | ||
| Right | 1042449979 | 8:68932870-68932892 | CATTGAAGCGATTTTAGAAAGGG | No data | ||||
| 1042449974_1042449980 | 21 | Left | 1042449974 | 8:68932831-68932853 | CCAATTGATTTACTTTGTATCAT | No data | ||
| Right | 1042449980 | 8:68932875-68932897 | AAGCGATTTTAGAAAGGGAGTGG | No data | ||||
| 1042449974_1042449978 | 15 | Left | 1042449974 | 8:68932831-68932853 | CCAATTGATTTACTTTGTATCAT | No data | ||
| Right | 1042449978 | 8:68932869-68932891 | CCATTGAAGCGATTTTAGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1042449974 | Original CRISPR | ATGATACAAAGTAAATCAAT TGG (reversed) | Intergenic | ||