ID: 1042449979

View in Genome Browser
Species Human (GRCh38)
Location 8:68932870-68932892
Sequence CATTGAAGCGATTTTAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042449974_1042449979 16 Left 1042449974 8:68932831-68932853 CCAATTGATTTACTTTGTATCAT No data
Right 1042449979 8:68932870-68932892 CATTGAAGCGATTTTAGAAAGGG No data
1042449973_1042449979 21 Left 1042449973 8:68932826-68932848 CCAAACCAATTGATTTACTTTGT No data
Right 1042449979 8:68932870-68932892 CATTGAAGCGATTTTAGAAAGGG No data
1042449972_1042449979 29 Left 1042449972 8:68932818-68932840 CCAATGAGCCAAACCAATTGATT No data
Right 1042449979 8:68932870-68932892 CATTGAAGCGATTTTAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042449979 Original CRISPR CATTGAAGCGATTTTAGAAA GGG Intergenic