ID: 1042449980

View in Genome Browser
Species Human (GRCh38)
Location 8:68932875-68932897
Sequence AAGCGATTTTAGAAAGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042449973_1042449980 26 Left 1042449973 8:68932826-68932848 CCAAACCAATTGATTTACTTTGT No data
Right 1042449980 8:68932875-68932897 AAGCGATTTTAGAAAGGGAGTGG No data
1042449974_1042449980 21 Left 1042449974 8:68932831-68932853 CCAATTGATTTACTTTGTATCAT No data
Right 1042449980 8:68932875-68932897 AAGCGATTTTAGAAAGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042449980 Original CRISPR AAGCGATTTTAGAAAGGGAG TGG Intergenic