ID: 1042450147

View in Genome Browser
Species Human (GRCh38)
Location 8:68935820-68935842
Sequence GTGCTAGGACAGCTTGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042450147_1042450150 -2 Left 1042450147 8:68935820-68935842 CCATGCTCAAGCTGTCCTAGCAC No data
Right 1042450150 8:68935841-68935863 ACCTCGGCCTCCTGAGTAACTGG 0: 13
1: 829
2: 19170
3: 127082
4: 230567
1042450147_1042450152 -1 Left 1042450147 8:68935820-68935842 CCATGCTCAAGCTGTCCTAGCAC No data
Right 1042450152 8:68935842-68935864 CCTCGGCCTCCTGAGTAACTGGG 0: 42
1: 4612
2: 110173
3: 215174
4: 243605
1042450147_1042450155 26 Left 1042450147 8:68935820-68935842 CCATGCTCAAGCTGTCCTAGCAC No data
Right 1042450155 8:68935869-68935891 CAAGCATGCACCACCACACCTGG 0: 141
1: 3854
2: 13118
3: 39275
4: 84092

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042450147 Original CRISPR GTGCTAGGACAGCTTGAGCA TGG (reversed) Intergenic
No off target data available for this crispr