ID: 1042454474

View in Genome Browser
Species Human (GRCh38)
Location 8:68984641-68984663
Sequence ACTGTTGGTGGCTCAGGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042454474_1042454479 24 Left 1042454474 8:68984641-68984663 CCTAATCCTGAGCCACCAACAGT No data
Right 1042454479 8:68984688-68984710 TCTATCAAACTACATCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042454474 Original CRISPR ACTGTTGGTGGCTCAGGATT AGG (reversed) Intergenic