ID: 1042454479

View in Genome Browser
Species Human (GRCh38)
Location 8:68984688-68984710
Sequence TCTATCAAACTACATCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042454478_1042454479 -4 Left 1042454478 8:68984669-68984691 CCACAAAAATGTGCAGTGATCTA No data
Right 1042454479 8:68984688-68984710 TCTATCAAACTACATCATCCTGG No data
1042454474_1042454479 24 Left 1042454474 8:68984641-68984663 CCTAATCCTGAGCCACCAACAGT No data
Right 1042454479 8:68984688-68984710 TCTATCAAACTACATCATCCTGG No data
1042454476_1042454479 12 Left 1042454476 8:68984653-68984675 CCACCAACAGTCTCTACCACAAA No data
Right 1042454479 8:68984688-68984710 TCTATCAAACTACATCATCCTGG No data
1042454477_1042454479 9 Left 1042454477 8:68984656-68984678 CCAACAGTCTCTACCACAAAAAT No data
Right 1042454479 8:68984688-68984710 TCTATCAAACTACATCATCCTGG No data
1042454475_1042454479 18 Left 1042454475 8:68984647-68984669 CCTGAGCCACCAACAGTCTCTAC No data
Right 1042454479 8:68984688-68984710 TCTATCAAACTACATCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042454479 Original CRISPR TCTATCAAACTACATCATCC TGG Intergenic