ID: 1042458994

View in Genome Browser
Species Human (GRCh38)
Location 8:69040203-69040225
Sequence TCTTATAGGCAGAGAGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042458994_1042458998 30 Left 1042458994 8:69040203-69040225 CCAGGTTCTCTCTGCCTATAAGA No data
Right 1042458998 8:69040256-69040278 CCAGAGAATATCAAAATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042458994 Original CRISPR TCTTATAGGCAGAGAGAACC TGG (reversed) Intergenic
No off target data available for this crispr