ID: 1042460312

View in Genome Browser
Species Human (GRCh38)
Location 8:69058157-69058179
Sequence AATATTTAGCACTTTGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042460304_1042460312 30 Left 1042460304 8:69058104-69058126 CCTGCCACAGTATTCTCTTCCAT No data
Right 1042460312 8:69058157-69058179 AATATTTAGCACTTTGTGCCAGG No data
1042460310_1042460312 -5 Left 1042460310 8:69058139-69058161 CCTGGTCACCATTGGTGCAATAT No data
Right 1042460312 8:69058157-69058179 AATATTTAGCACTTTGTGCCAGG No data
1042460308_1042460312 11 Left 1042460308 8:69058123-69058145 CCATAGAGGCATTTTTCCTGGTC No data
Right 1042460312 8:69058157-69058179 AATATTTAGCACTTTGTGCCAGG No data
1042460305_1042460312 26 Left 1042460305 8:69058108-69058130 CCACAGTATTCTCTTCCATAGAG No data
Right 1042460312 8:69058157-69058179 AATATTTAGCACTTTGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042460312 Original CRISPR AATATTTAGCACTTTGTGCC AGG Intergenic
No off target data available for this crispr