ID: 1042461004

View in Genome Browser
Species Human (GRCh38)
Location 8:69068456-69068478
Sequence GGTAATTGGTTTCGGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 41}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042461004_1042461007 -5 Left 1042461004 8:69068456-69068478 CCAGCACACCGAAACCAATTACC 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1042461007 8:69068474-69068496 TTACCTCAGTTTTTTCTCACTGG 0: 1
1: 0
2: 0
3: 21
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042461004 Original CRISPR GGTAATTGGTTTCGGTGTGC TGG (reversed) Intergenic
916318145 1:163473207-163473229 GGAAAATGGTCTCTGTGTGCTGG - Intergenic
923205063 1:231750988-231751010 AGTAATTGGTCTCACTGTGCAGG - Intronic
1078208948 11:9254400-9254422 TGTAATTGTTTTCTGTGTGTGGG + Intronic
1078805791 11:14701525-14701547 AGTAATTGCTTTTGGAGTGCAGG - Intronic
1082662576 11:55930704-55930726 TGTAATTGGTTTTGGTATGCAGG + Intergenic
1082989347 11:59194004-59194026 GGGAATAGGATTCGGTGTCCAGG + Intronic
1086492671 11:87371040-87371062 AGAAATTGGTTTCGCTCTGCAGG - Intergenic
1108079544 13:46720391-46720413 GGTGATTGGTTTTGGGGGGCGGG - Intronic
1115843358 14:37497319-37497341 TGTAATTGGTTACGGTATACTGG + Intronic
1126487930 15:49203336-49203358 GGCAAATGGTCTCGGTGTGGTGG - Intronic
1145260584 17:21352258-21352280 GGTAATTGATTGCCCTGTGCCGG - Intergenic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
928423865 2:31161814-31161836 GCAAATTGGTTTCCGTCTGCTGG - Intergenic
934857524 2:97738481-97738503 GGTAGTTGGGTGCTGTGTGCTGG - Intronic
945221159 2:207485621-207485643 GTTAATGGGTTTCTGTGAGCTGG + Intergenic
1169183871 20:3595199-3595221 AGTAATTGTTTTTGGTGTCCTGG + Intronic
1170459693 20:16565743-16565765 GTTGATTTGTTTCGGGGTGCTGG - Intronic
1174946462 20:54991647-54991669 GGAAAATGGTTTCAGTGGGCTGG - Intergenic
1180175033 21:46083189-46083211 GGTAATTGGGTGCGTTGAGCAGG + Intergenic
954235552 3:49254559-49254581 GGTGATTGGTTGCGGGGGGCGGG + Intronic
956036389 3:65096739-65096761 GGTAATTAGTGACGGTGTTCTGG - Intergenic
959165805 3:102776664-102776686 GGTAGTTTCTTTTGGTGTGCAGG + Intergenic
959989375 3:112613983-112614005 AGTAATTGGTTTAGGCATGCAGG + Intronic
961150419 3:124632903-124632925 GGCAAATGGTTTCTGTCTGCTGG - Intronic
963403590 3:144834589-144834611 GGTAATTGGTGACCATGTGCAGG - Intergenic
964594061 3:158401785-158401807 GGTAATTTGTTTCTGTGAACTGG - Intronic
968849189 4:3066814-3066836 GGTAATTTGTGTTTGTGTGCTGG - Intergenic
970782464 4:19754773-19754795 GCTACTTGGTCTCGATGTGCAGG - Intergenic
986250473 5:6053399-6053421 GGTTATTGGATTGGGGGTGCGGG - Intergenic
987298065 5:16571793-16571815 GGTAAAAGGTTTGTGTGTGCTGG - Intronic
988402572 5:30780564-30780586 GATAGTTGCTTTTGGTGTGCAGG - Intergenic
996668712 5:126091125-126091147 GGTACTTTCTTTTGGTGTGCAGG - Intergenic
1014341554 6:120214044-120214066 GGCAAATGTTTTTGGTGTGCTGG - Intergenic
1024231424 7:47366831-47366853 GGTTCTTGGTTTAGGTGTGCTGG - Intronic
1024866903 7:53913575-53913597 GGTAATTGGTTGGGGTGAGGGGG + Intergenic
1025647571 7:63433258-63433280 GGTGGTTGGTTTCTGTCTGCAGG - Intergenic
1033200668 7:139366666-139366688 GGTAAATGTTTTCGGTTTGCGGG - Intronic
1033672118 7:143503447-143503469 GGTAATTGATTTTGATGTGGAGG + Intergenic
1042461004 8:69068456-69068478 GGTAATTGGTTTCGGTGTGCTGG - Intergenic
1045085316 8:98676932-98676954 AATAATTGGTTTAGGGGTGCTGG - Intronic
1046709305 8:117491800-117491822 GGTAATTTCTTTTGCTGTGCAGG - Intergenic
1051713278 9:19955163-19955185 GGTAATTGTTTCCTGTGTGGTGG + Intergenic
1058861074 9:109118673-109118695 GGTAACTGCTTTTGTTGTGCAGG - Intronic
1059530698 9:115032840-115032862 GGTCATTGGTTTCAGTTTGCAGG + Intronic
1190588355 X:51970349-51970371 TGTATTTGGTTTCGGTGTCAGGG - Intergenic
1197172743 X:123452701-123452723 GGTAATTGGCTTTGGATTGCTGG + Intronic