ID: 1042462986

View in Genome Browser
Species Human (GRCh38)
Location 8:69092412-69092434
Sequence TATGCATGGCCACACAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042462986_1042462989 24 Left 1042462986 8:69092412-69092434 CCATTTTTGTGTGGCCATGCATA No data
Right 1042462989 8:69092459-69092481 CTCTATAGGTAACAAAGACATGG No data
1042462986_1042462988 10 Left 1042462986 8:69092412-69092434 CCATTTTTGTGTGGCCATGCATA No data
Right 1042462988 8:69092445-69092467 TAGTCTTCTATTTTCTCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042462986 Original CRISPR TATGCATGGCCACACAAAAA TGG (reversed) Intergenic
No off target data available for this crispr