ID: 1042471132

View in Genome Browser
Species Human (GRCh38)
Location 8:69189278-69189300
Sequence TTTCCTCTGTGGTGTACTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042471127_1042471132 1 Left 1042471127 8:69189254-69189276 CCCCAGAATGTATATAGTGTAGA No data
Right 1042471132 8:69189278-69189300 TTTCCTCTGTGGTGTACTGGTGG No data
1042471126_1042471132 28 Left 1042471126 8:69189227-69189249 CCTGGTGTTTCTTCTCACGTCTC No data
Right 1042471132 8:69189278-69189300 TTTCCTCTGTGGTGTACTGGTGG No data
1042471128_1042471132 0 Left 1042471128 8:69189255-69189277 CCCAGAATGTATATAGTGTAGAT No data
Right 1042471132 8:69189278-69189300 TTTCCTCTGTGGTGTACTGGTGG No data
1042471129_1042471132 -1 Left 1042471129 8:69189256-69189278 CCAGAATGTATATAGTGTAGATT No data
Right 1042471132 8:69189278-69189300 TTTCCTCTGTGGTGTACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042471132 Original CRISPR TTTCCTCTGTGGTGTACTGG TGG Intergenic
No off target data available for this crispr