ID: 1042471296

View in Genome Browser
Species Human (GRCh38)
Location 8:69191459-69191481
Sequence GCCAACTAAAAAATAATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042471295_1042471296 -4 Left 1042471295 8:69191440-69191462 CCATTTAAGTGGAATTTTTGCCA No data
Right 1042471296 8:69191459-69191481 GCCAACTAAAAAATAATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042471296 Original CRISPR GCCAACTAAAAAATAATTGA AGG Intergenic
No off target data available for this crispr