ID: 1042474684

View in Genome Browser
Species Human (GRCh38)
Location 8:69233783-69233805
Sequence CTGCATCTTTATATGGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042474681_1042474684 -2 Left 1042474681 8:69233762-69233784 CCTCTAAGATGGCGTCCTTTGCT No data
Right 1042474684 8:69233783-69233805 CTGCATCTTTATATGGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042474684 Original CRISPR CTGCATCTTTATATGGAGTA AGG Intergenic
No off target data available for this crispr