ID: 1042482424

View in Genome Browser
Species Human (GRCh38)
Location 8:69319281-69319303
Sequence GAGACAGGTGTGACTACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042482424_1042482431 19 Left 1042482424 8:69319281-69319303 CCTTCTGTAGTCACACCTGTCTC No data
Right 1042482431 8:69319323-69319345 TTCTCCCTCTTCTACTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042482424 Original CRISPR GAGACAGGTGTGACTACAGA AGG (reversed) Intergenic
No off target data available for this crispr