ID: 1042490330

View in Genome Browser
Species Human (GRCh38)
Location 8:69390592-69390614
Sequence AAGAATTAGCTGGATGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042490330_1042490336 18 Left 1042490330 8:69390592-69390614 CCCTCTTCATCCAGCTAATTCTT No data
Right 1042490336 8:69390633-69390655 AGTTAAGTCCCTCCTTCTTGAGG No data
1042490330_1042490337 22 Left 1042490330 8:69390592-69390614 CCCTCTTCATCCAGCTAATTCTT No data
Right 1042490337 8:69390637-69390659 AAGTCCCTCCTTCTTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042490330 Original CRISPR AAGAATTAGCTGGATGAAGA GGG (reversed) Intergenic
No off target data available for this crispr