ID: 1042497412

View in Genome Browser
Species Human (GRCh38)
Location 8:69470645-69470667
Sequence CTGCAGTAGTAGACAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042497412 Original CRISPR CTGCAGTAGTAGACAGAAGA GGG (reversed) Intronic
902884026 1:19392223-19392245 CTGCAGGAGACGACAGAAGGGGG + Intronic
905268123 1:36769003-36769025 CTGAAGTAATAGACAGATAACGG - Intergenic
906848263 1:49218451-49218473 CTGGAGAAGTAGTCAGAAAATGG + Intronic
907820053 1:57958476-57958498 GTGCAGGAGTGGACAGAAAATGG + Intronic
909465027 1:75963951-75963973 CTGCAGAAGCAGCCAGATGAAGG + Intergenic
909873588 1:80776878-80776900 CTGCAGTCTGAGACAGATGATGG - Intergenic
911695692 1:100888795-100888817 CTTCAGTAATTGACAGAAGCAGG + Exonic
913610215 1:120503506-120503528 CTGGAGAAGCAAACAGAAGAAGG - Intergenic
914580975 1:149018733-149018755 CTGGAGAAGCAAACAGAAGAAGG + Intronic
915392920 1:155561029-155561051 CTGCAGTAGTAGTGAAAATATGG + Intronic
915409076 1:155686947-155686969 CTGCAGTAGTAGTGAAAATATGG + Intronic
915752901 1:158228536-158228558 CTGCAGTAGAATACAGCAGTAGG + Intergenic
920255402 1:204651069-204651091 CTCCAGCAGCAGGCAGAAGAGGG + Intronic
920312729 1:205058158-205058180 CTGCAGCAGGGGACAGAGGAAGG - Intronic
923113664 1:230914048-230914070 GTGAAGCAGGAGACAGAAGATGG + Intronic
923291271 1:232548656-232548678 CTGCAGGAGTAGTGAAAAGAGGG + Intronic
924482159 1:244445783-244445805 CTGCTGTGGTAGAGAGATGAAGG + Intronic
1063478571 10:6350192-6350214 CTGCAGTAGAAGGCACGAGAAGG - Intergenic
1064603333 10:17014899-17014921 GTGCAGGAGAATACAGAAGAAGG + Intronic
1068131269 10:52898029-52898051 CGGCAGAAGTAGACAGAGGCAGG - Intergenic
1068472050 10:57477847-57477869 GGGCAGTAGTTGGCAGAAGATGG - Intergenic
1068956252 10:62820502-62820524 CTGGAGTGGAAGACAAAAGAAGG + Intronic
1070445849 10:76501257-76501279 CATCAGTAGTAGACTGAATAAGG - Intronic
1070974965 10:80599274-80599296 CTGAAGGAGAAGACAGAAGAAGG + Intronic
1072932648 10:99680264-99680286 TTGCAGTAGCAGCAAGAAGAGGG - Intronic
1076438546 10:130463205-130463227 CTGGAGCAGCTGACAGAAGAGGG + Intergenic
1078038857 11:7838318-7838340 CTGCTGTGGAAGACAGTAGAAGG - Intergenic
1078728191 11:13951378-13951400 TTTCAGGAGTAGGCAGAAGATGG + Intergenic
1078830977 11:14976325-14976347 CAGCAGTATTATTCAGAAGAAGG + Intronic
1079831006 11:25267448-25267470 ATGCATTAGGAGACAAAAGATGG - Intergenic
1083514790 11:63246810-63246832 GTGCAGTTGGAGACAGAGGAGGG - Intronic
1086673554 11:89575751-89575773 ATGAAGTAGAAGAAAGAAGAAGG - Intergenic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1088835128 11:113571449-113571471 CTGCATGAGTAGACTGGAGAAGG + Intergenic
1089059818 11:115617280-115617302 CTCCAGCTGCAGACAGAAGAAGG - Intergenic
1090077284 11:123587414-123587436 CTGCCCTAGTAGACATGAGATGG + Intronic
1090810989 11:130242888-130242910 CTGCAGTAGCAAAGAGGAGAAGG - Intronic
1092586618 12:9907310-9907332 CTTCAGAAGTCCACAGAAGATGG + Intronic
1093235758 12:16606787-16606809 CTGCAGGAGTCGACTGAGGAAGG + Intronic
1098773009 12:74578627-74578649 CTGCAGTAGTGGAAAAAAGTTGG - Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100690723 12:97036084-97036106 CTGGTGTAGTAAAAAGAAGATGG - Intergenic
1101733569 12:107446109-107446131 CCACTGTAGTAGACAGAATAAGG - Intronic
1104580297 12:130006671-130006693 CTGCAGCGGCAGACAGGAGACGG - Intergenic
1105624813 13:22102385-22102407 CCACAGTGGAAGACAGAAGAGGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107347826 13:39481900-39481922 CTGGAGCAGTAGAGAGATGATGG + Intronic
1107783354 13:43928497-43928519 CTGCAGCTGTAGACATAAAAGGG + Intergenic
1108228608 13:48316369-48316391 CTGCAGTGGTAGCCTGAGGAAGG - Intronic
1109401218 13:61831195-61831217 CTGAATTAGAGGACAGAAGAAGG - Intergenic
1110239916 13:73255842-73255864 CTGCACTAATCCACAGAAGAAGG - Intergenic
1112207231 13:97336929-97336951 GTTCAGGAGTGGACAGAAGAAGG - Intronic
1114605313 14:23991208-23991230 AAGCAATAGTAGACAGAATAGGG + Intronic
1116458394 14:45144513-45144535 CTGCAGTAGTATAGAGCACAAGG - Intronic
1117098226 14:52318657-52318679 CTCCAGTAGTGGACAGAGGAGGG + Intronic
1118106567 14:62666521-62666543 CTGCAGTCATAGAGAGCAGAAGG + Intergenic
1118160568 14:63285658-63285680 CTACAGTAATAGAAAGAAGAGGG - Intronic
1119439835 14:74620665-74620687 CTGGAGTAGTAGGAAGAACAAGG + Intergenic
1119709258 14:76809505-76809527 CTGCAGCAGTGGCGAGAAGAAGG - Exonic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123471966 15:20562328-20562350 ATGCAGTAGAAGGCAGAATAGGG - Intergenic
1123646037 15:22438025-22438047 ATGCAGTAGAAGGCAGAATAGGG + Intergenic
1123732270 15:23157319-23157341 ATGCAGTAGAAGGCAGAATAGGG - Intergenic
1123750405 15:23354701-23354723 ATGCAGTAGAAGGCAGAATAGGG - Intergenic
1123813910 15:23957067-23957089 CTGCAGTAGTTGAGGGAAGTAGG + Intergenic
1124282775 15:28378617-28378639 ATGCAGTAGAAGGCAGAATAGGG - Intronic
1124299924 15:28532996-28533018 ATGCAGTAGAAGGCAGAATAGGG + Intronic
1124547076 15:30639573-30639595 CTGCAGTAGAAGCAAGAAGTTGG + Intronic
1126402001 15:48281540-48281562 CTGAAGGAGAAGAGAGAAGAGGG + Intronic
1127047578 15:55043265-55043287 CAGCAGTGGTGGACAGAACAGGG + Intergenic
1128318451 15:66676128-66676150 CTCCAAGAGTAGACACAAGAGGG + Intronic
1128543833 15:68554497-68554519 TTGCAGAACTAGTCAGAAGATGG + Intergenic
1132838386 16:1966089-1966111 CCGCAGTATTGGAGAGAAGAGGG + Intergenic
1133673376 16:8045873-8045895 CTGCTGTAGTAGACAAATGTTGG + Intergenic
1136421272 16:30134994-30135016 CTGAAGTAGTAGACAGGTGTTGG - Intergenic
1137447700 16:48541972-48541994 CTGCAGTTGGGGACACAAGATGG + Exonic
1137574371 16:49589044-49589066 CTTCAGTTGTTGACAGAGGAGGG - Intronic
1137924460 16:52526687-52526709 CAGGCGTAGTAGAGAGAAGAGGG + Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1143308780 17:5971132-5971154 CTGGAGTAGAAGTCACAAGAGGG + Intronic
1143369741 17:6431597-6431619 ATAGAGTAGCAGACAGAAGACGG + Intronic
1145274890 17:21423364-21423386 TTGCAGTGGGAGACAGCAGAAGG + Intergenic
1145312741 17:21709263-21709285 TTGCAGTGGGAGACAGAAGAAGG + Intergenic
1150621047 17:66807892-66807914 CTGCAGTAGGAGGGAGAGGAAGG + Exonic
1151283863 17:73095867-73095889 CTACAGTATAAGACAGAAGGAGG - Intergenic
1152087057 17:78226782-78226804 CTGCAGGAGTACCGAGAAGACGG + Intergenic
1153124054 18:1768596-1768618 TTGCAGTAGTAGACTAGAGAAGG - Intergenic
1153980349 18:10303428-10303450 CTGCAGAAGTAGAGAGAAATGGG - Intergenic
1156658792 18:39320725-39320747 ATGCAGGTATAGACAGAAGAAGG - Intergenic
1161470793 19:4455998-4456020 CTGCAGTGGTGGACAGGAGAAGG - Intronic
1164073776 19:21793955-21793977 CTGCAGTAGAGGACACAGGATGG - Intergenic
1165620217 19:37239802-37239824 TGGCAGTGGAAGACAGAAGAGGG + Intronic
1165950569 19:39472118-39472140 CTGCTGTTTTAGACAGAGGAGGG + Intronic
1168326400 19:55540898-55540920 CTGGAGGAGTGGACAGATGAGGG - Exonic
927251551 2:20999260-20999282 ATGCAGTAGAAGACCTAAGAAGG + Intergenic
929304173 2:40341058-40341080 ATGGAGTAGTAGAGAGAAGAGGG + Intronic
929391973 2:41479553-41479575 CTGCAGTAGTACACAGCATGGGG + Intergenic
929404172 2:41622478-41622500 CTCAAGTAGGAGACAGCAGATGG + Intergenic
932481050 2:72039567-72039589 CTGCTGTGTTAGACAGAGGAAGG + Intergenic
933134812 2:78720009-78720031 CTACAGTAGTAGACTAGAGATGG - Intergenic
935410981 2:102761825-102761847 CCACAGAAGTAGAAAGAAGATGG - Intronic
936245905 2:110827246-110827268 CTGCAGGAGTAGCCAAAAGAGGG + Intronic
936248125 2:110846242-110846264 CTCCTTTAGTAGACAGAAGAGGG + Intronic
936683480 2:114801680-114801702 CTTCAGTAGAATACAGAAAAGGG + Intronic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
938386368 2:130870096-130870118 CTGCAGGGGTTGACAGCAGAGGG - Intronic
938985991 2:136576929-136576951 GAGCAGTAGTAAAAAGAAGAGGG - Intergenic
939441015 2:142249298-142249320 CTGCAGAACTACACAGAGGAGGG + Intergenic
943809319 2:192164342-192164364 CTTAAGTAGTAGAAAGAACAAGG - Intronic
945060565 2:205905133-205905155 CTGTAGTAATAGAAAGCAGATGG - Intergenic
945976897 2:216277923-216277945 TTGGAGCAGCAGACAGAAGAGGG - Intronic
1169555787 20:6748338-6748360 ATGCAGAAGCAGACAAAAGATGG + Intergenic
1169589748 20:7127305-7127327 TTACAGTAGTTGACAGAAAATGG + Intergenic
1170109599 20:12790528-12790550 CTCCTTTAGTAGACAGGAGATGG - Intergenic
1170121453 20:12916892-12916914 CTGCATGAGTAGTCAGCAGATGG - Intergenic
1170857891 20:20074279-20074301 CTGCAGAAGAAGAGAGAACACGG - Intronic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171353175 20:24521238-24521260 ATGCAGAAGTAGTCAGAAGGTGG - Intronic
1171491388 20:25520717-25520739 CAACAGTAGAAGTCAGAAGACGG - Intronic
1176699515 21:10026917-10026939 GTGCATTAGGAGACTGAAGAAGG - Intergenic
1177124866 21:17182729-17182751 GTGCAATGGTAGGCAGAAGAAGG - Intergenic
1181107995 22:20585956-20585978 GTGCAGGAGGAGCCAGAAGAGGG - Intronic
1183756328 22:39769645-39769667 CTGCAGTAGTACTCAGAGGAAGG + Intronic
1184648953 22:45910919-45910941 CTGGAGCAGGGGACAGAAGAGGG - Intergenic
950078654 3:10205668-10205690 CTGCAGTGGTACACAGAACCTGG + Intronic
953383836 3:42493519-42493541 CTGCAGTGGGGGACAGAGGAGGG + Intronic
953511063 3:43539555-43539577 GTGCAGTAGGAGACAGCAGAGGG + Intronic
959740442 3:109712362-109712384 CTACAGTAGAAGAAAGAATAGGG - Intergenic
960744562 3:120872855-120872877 AGGCAGTAGGAGAAAGAAGAAGG + Intergenic
960750102 3:120939458-120939480 TTCCAGTAGTAGACAGGGGAGGG - Intronic
962658443 3:137574058-137574080 CTTGAGGAGGAGACAGAAGATGG + Intergenic
963632453 3:147750257-147750279 CTGGAGTATGAGACAGAATAAGG + Intergenic
965213162 3:165822713-165822735 CTGCAAGAGTAGAAAGAAGCTGG + Intronic
965777813 3:172251379-172251401 CTGCTTTTGTAGATAGAAGAAGG - Exonic
966630950 3:182074472-182074494 CTACCTCAGTAGACAGAAGATGG + Intergenic
967132756 3:186487755-186487777 CTGCAGGAGGAGCCAGAATAGGG + Intergenic
968059578 3:195717103-195717125 CTGCAGTACTAAATAGCAGAGGG - Intergenic
968449857 4:670023-670045 CTGCAAGAGAAGACAGAAGATGG - Intronic
970148943 4:13068856-13068878 CTGCAGAAGGAGCCAGGAGATGG + Intergenic
971183092 4:24349312-24349334 CTGCAGTAGTAGTGTGGAGAGGG + Intergenic
972731358 4:41798457-41798479 CATCAGTAGAAGACAAAAGATGG + Intergenic
974537339 4:63188569-63188591 GTGCAGGAGAATACAGAAGAAGG - Intergenic
976534997 4:86202608-86202630 TTGCAGTAGTAGAAATATGAAGG + Intronic
976904200 4:90216316-90216338 ATGCCTTAGTACACAGAAGAAGG - Intronic
977468114 4:97407379-97407401 AAGCAGTAGGAGAAAGAAGAAGG - Intronic
980371926 4:131885551-131885573 GTGCATTAGGAGACTGAAGAAGG - Intergenic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
982927971 4:161363870-161363892 GTGCACTGGTTGACAGAAGAAGG + Intergenic
983684694 4:170394570-170394592 CTGCAGCAGCAGACAGCAGGTGG - Intergenic
983704235 4:170638411-170638433 CTGAAGAAGTAACCAGAAGAAGG - Intergenic
984248189 4:177300709-177300731 CTGGGGTGGTAGACAGAATAGGG - Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989516684 5:42352187-42352209 CTGAAATAGTACACAGAAGGAGG + Intergenic
990573245 5:57100188-57100210 TTCCAGTAGTATACTGAAGAGGG - Intergenic
993516806 5:88846701-88846723 ATGCAGTAGAAAAAAGAAGAAGG - Intronic
993911686 5:93691189-93691211 CAGAAGTAGGAGTCAGAAGATGG + Intronic
998817683 5:146030528-146030550 CTACAGACGTAGACAGATGAGGG - Intronic
999675174 5:153992905-153992927 CTGCAGGAGTAGCCAGAATAAGG + Exonic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1002353712 5:178605792-178605814 CTGAAGTAGAATACAGAAAACGG + Intronic
1003477910 6:6501811-6501833 CTGCAGCAGCTGACAGAAGATGG + Intergenic
1004294712 6:14400166-14400188 GGGCAGTAGTAAACAGGAGAGGG + Intergenic
1004576965 6:16905861-16905883 GTCCAGTAGAACACAGAAGAGGG - Intergenic
1006998469 6:38285240-38285262 ATGCAGTGGGACACAGAAGAGGG + Intronic
1008431202 6:51419399-51419421 CTGCACTAGTTGACAGAACTTGG - Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1008810031 6:55485215-55485237 GTGCAGTAAGATACAGAAGATGG - Intronic
1009551240 6:65095216-65095238 CTGCAGAAGTAAACAGTAAAAGG + Intronic
1009718751 6:67436118-67436140 CCCAAGTAGTAGAAAGAAGAGGG - Intergenic
1015633891 6:135257082-135257104 CTGCAGTACTTGACAGAGGGTGG + Intergenic
1017293335 6:152766203-152766225 CAGCAGTAGGAGAAAGATGAAGG + Intergenic
1017337121 6:153274302-153274324 CTGCAGTAGTAAACAAAGTATGG - Intergenic
1018788516 6:167128012-167128034 CTGGAGTTGCAGACAGAAGAGGG - Intronic
1020025887 7:4899752-4899774 CTGTGGGAGTAAACAGAAGACGG + Intergenic
1020370138 7:7422816-7422838 TTACAGTAATAGACGGAAGAGGG + Intronic
1022648810 7:32256373-32256395 CTGGAGTAGTAGGCCCAAGAGGG + Intronic
1022731782 7:33033217-33033239 CTGCAGTGGTACAAAGAAGTAGG + Intronic
1027814879 7:82955639-82955661 CTTCAATAGTAGGCAAAAGAGGG + Exonic
1028021399 7:85779734-85779756 CTGCAGTAAGAGACAAAATAAGG + Intergenic
1028689073 7:93629910-93629932 CTCCAAAAGTAGACAGAAGCTGG - Intronic
1032310684 7:130783947-130783969 CTGAAATAGAAGATAGAAGATGG - Intergenic
1034206556 7:149321120-149321142 CTGCACCAGTAGACAGAACTTGG + Intergenic
1034413345 7:150952666-150952688 CTGCTGAAGGAGACGGAAGAAGG - Exonic
1035201565 7:157270764-157270786 CTGCAGAGGTAGGCAGAAAACGG + Intergenic
1036812100 8:11874307-11874329 CTGTAGCTGTAGTCAGAAGAGGG + Intergenic
1037394133 8:18424175-18424197 GGGAAATAGTAGACAGAAGATGG - Intergenic
1039142201 8:34402711-34402733 CTGCAGTAGTAGAAACTGGAAGG - Intergenic
1039685790 8:39801003-39801025 ATGGAGTAATTGACAGAAGATGG - Intronic
1042497412 8:69470645-69470667 CTGCAGTAGTAGACAGAAGAGGG - Intronic
1044793171 8:95868739-95868761 CTGCAGGAGAAGGCAGAAGAAGG - Intergenic
1045175649 8:99721852-99721874 CTGGAGTAGGGAACAGAAGATGG - Intronic
1046706193 8:117455015-117455037 CTGTAGAAGTTCACAGAAGAGGG + Intergenic
1051104159 9:13559035-13559057 ATGCAGTGGTAGACAGAGAAGGG - Intergenic
1051617473 9:19019887-19019909 ATGCTGTAGTTTACAGAAGAGGG - Intronic
1052466402 9:28835854-28835876 GTGCAGTAATAGAAAGAAAATGG - Intergenic
1053066889 9:35075326-35075348 CTGAAGTAGGACACAGAACAGGG + Intronic
1053636630 9:40013105-40013127 GTGCATTAGGAGACTGAAGAAGG - Intergenic
1053769362 9:41451511-41451533 GTGCATTAGGAGACTGAAGAAGG + Intergenic
1054317492 9:63610179-63610201 GTGCATTAGGAGACTGAAGAAGG - Intergenic
1054548030 9:66363014-66363036 GTGCATTAGGAGACTGAAGAAGG + Intergenic
1054910672 9:70452470-70452492 CTTCAGAAGGTGACAGAAGAAGG + Intergenic
1055798863 9:80009097-80009119 CTGCAGTAGCAGAAACACGATGG + Intergenic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1057641959 9:96833062-96833084 CAGCAGCAGAAGAGAGAAGACGG - Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058013809 9:100007673-100007695 CTACAGGAATTGACAGAAGAAGG - Exonic
1059743039 9:117171681-117171703 AGGCAGTAGGAGAGAGAAGAAGG - Intronic
1059977407 9:119732101-119732123 CTGCCTTTGGAGACAGAAGAAGG + Intergenic
1062232317 9:135488533-135488555 CTGCAGTGGTAGCCTGAGGAAGG + Exonic
1185713026 X:2319245-2319267 CTGCAGGAGTAGGGAGAGGAGGG - Intronic
1186285229 X:8036388-8036410 CTGCATTATTAGATAGAAGCTGG - Intergenic
1187252653 X:17612787-17612809 CTGCTGTAGAAGCCAGAACAGGG - Intronic
1191882970 X:65860670-65860692 CTGGAGAAGTAGACAAAGGATGG + Intergenic
1193413755 X:81196881-81196903 TGGCAGCAGGAGACAGAAGAGGG - Intronic
1193514340 X:82445607-82445629 CTGGAGGTGTAGACACAAGAGGG - Intergenic
1195253860 X:103074951-103074973 CTGCAGTCGTTGAGATAAGATGG - Intergenic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1196706810 X:118724173-118724195 CTGCAGGACTAGACAGTGGATGG + Intergenic
1196917799 X:120556762-120556784 CTGGATTAGGAGTCAGAAGATGG - Intronic
1198266304 X:135012231-135012253 CTAAAGTAATACACAGAAGAAGG + Intergenic
1199342109 X:146693050-146693072 CTGCAGCAGAACATAGAAGAGGG + Intergenic
1200799959 Y:7377495-7377517 GTGCAGAAGGAGACAGATGAAGG - Intergenic