ID: 1042497905 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:69476211-69476233 |
Sequence | ATTTGTCTTTGTAGTGAAGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 15982 | |||
Summary | {0: 1, 1: 0, 2: 9, 3: 426, 4: 15546} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1042497905_1042497906 | -1 | Left | 1042497905 | 8:69476211-69476233 | CCTTCTTCACTACAAAGACAAAT | 0: 1 1: 0 2: 9 3: 426 4: 15546 |
||
Right | 1042497906 | 8:69476233-69476255 | TCATCCTTAATTTTATGATTTGG | No data | ||||
1042497905_1042497907 | 0 | Left | 1042497905 | 8:69476211-69476233 | CCTTCTTCACTACAAAGACAAAT | 0: 1 1: 0 2: 9 3: 426 4: 15546 |
||
Right | 1042497907 | 8:69476234-69476256 | CATCCTTAATTTTATGATTTGGG | No data | ||||
1042497905_1042497909 | 5 | Left | 1042497905 | 8:69476211-69476233 | CCTTCTTCACTACAAAGACAAAT | 0: 1 1: 0 2: 9 3: 426 4: 15546 |
||
Right | 1042497909 | 8:69476239-69476261 | TTAATTTTATGATTTGGGAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1042497905 | Original CRISPR | ATTTGTCTTTGTAGTGAAGA AGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |