ID: 1042497905

View in Genome Browser
Species Human (GRCh38)
Location 8:69476211-69476233
Sequence ATTTGTCTTTGTAGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15982
Summary {0: 1, 1: 0, 2: 9, 3: 426, 4: 15546}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042497905_1042497906 -1 Left 1042497905 8:69476211-69476233 CCTTCTTCACTACAAAGACAAAT 0: 1
1: 0
2: 9
3: 426
4: 15546
Right 1042497906 8:69476233-69476255 TCATCCTTAATTTTATGATTTGG No data
1042497905_1042497907 0 Left 1042497905 8:69476211-69476233 CCTTCTTCACTACAAAGACAAAT 0: 1
1: 0
2: 9
3: 426
4: 15546
Right 1042497907 8:69476234-69476256 CATCCTTAATTTTATGATTTGGG No data
1042497905_1042497909 5 Left 1042497905 8:69476211-69476233 CCTTCTTCACTACAAAGACAAAT 0: 1
1: 0
2: 9
3: 426
4: 15546
Right 1042497909 8:69476239-69476261 TTAATTTTATGATTTGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042497905 Original CRISPR ATTTGTCTTTGTAGTGAAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr