ID: 1042500482

View in Genome Browser
Species Human (GRCh38)
Location 8:69503191-69503213
Sequence TATTACGTGAAGAAAGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042500481_1042500482 -8 Left 1042500481 8:69503176-69503198 CCTTCATTCTACAAGTATTACGT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1042500482 8:69503191-69503213 TATTACGTGAAGAAAGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042500482 Original CRISPR TATTACGTGAAGAAAGTGAA TGG Intronic
No off target data available for this crispr