ID: 1042505429

View in Genome Browser
Species Human (GRCh38)
Location 8:69554803-69554825
Sequence CTGTATTTTCAGTAAAGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355092
Summary {0: 2, 1: 186, 2: 7524, 3: 119375, 4: 228005}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042505429_1042505435 2 Left 1042505429 8:69554803-69554825 CCCCGTCTTTACTGAAAATACAG 0: 2
1: 186
2: 7524
3: 119375
4: 228005
Right 1042505435 8:69554828-69554850 AATTAGCCAGGCGTGGTGGCAGG 0: 10854
1: 43830
2: 75611
3: 71380
4: 47791
1042505429_1042505432 -10 Left 1042505429 8:69554803-69554825 CCCCGTCTTTACTGAAAATACAG 0: 2
1: 186
2: 7524
3: 119375
4: 228005
Right 1042505432 8:69554816-69554838 GAAAATACAGAAAATTAGCCAGG 0: 18
1: 1857
2: 57245
3: 53362
4: 43247
1042505429_1042505439 26 Left 1042505429 8:69554803-69554825 CCCCGTCTTTACTGAAAATACAG 0: 2
1: 186
2: 7524
3: 119375
4: 228005
Right 1042505439 8:69554852-69554874 GCCTGTGGTCCCAGCTACTCGGG 0: 4596
1: 84607
2: 202440
3: 237495
4: 171610
1042505429_1042505433 -5 Left 1042505429 8:69554803-69554825 CCCCGTCTTTACTGAAAATACAG 0: 2
1: 186
2: 7524
3: 119375
4: 228005
Right 1042505433 8:69554821-69554843 TACAGAAAATTAGCCAGGCGTGG 0: 83
1: 9317
2: 35214
3: 49436
4: 70399
1042505429_1042505434 -2 Left 1042505429 8:69554803-69554825 CCCCGTCTTTACTGAAAATACAG 0: 2
1: 186
2: 7524
3: 119375
4: 228005
Right 1042505434 8:69554824-69554846 AGAAAATTAGCCAGGCGTGGTGG 0: 180
1: 19008
2: 85673
3: 169652
4: 199136
1042505429_1042505437 11 Left 1042505429 8:69554803-69554825 CCCCGTCTTTACTGAAAATACAG 0: 2
1: 186
2: 7524
3: 119375
4: 228005
Right 1042505437 8:69554837-69554859 GGCGTGGTGGCAGGCGCCTGTGG 0: 127
1: 838
2: 2007
3: 4726
4: 8320
1042505429_1042505438 25 Left 1042505429 8:69554803-69554825 CCCCGTCTTTACTGAAAATACAG 0: 2
1: 186
2: 7524
3: 119375
4: 228005
Right 1042505438 8:69554851-69554873 CGCCTGTGGTCCCAGCTACTCGG 0: 1698
1: 50471
2: 116116
3: 175602
4: 127583
1042505429_1042505441 29 Left 1042505429 8:69554803-69554825 CCCCGTCTTTACTGAAAATACAG 0: 2
1: 186
2: 7524
3: 119375
4: 228005
Right 1042505441 8:69554855-69554877 TGTGGTCCCAGCTACTCGGGAGG 0: 2602
1: 67707
2: 190379
3: 267428
4: 183071

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042505429 Original CRISPR CTGTATTTTCAGTAAAGACG GGG (reversed) Intronic
Too many off-targets to display for this crispr