ID: 1042508096

View in Genome Browser
Species Human (GRCh38)
Location 8:69582726-69582748
Sequence GGCCTCCTCCTCATCCCTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 235}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042508096_1042508103 -1 Left 1042508096 8:69582726-69582748 CCCGTAGGGATGAGGAGGAGGCC 0: 1
1: 0
2: 1
3: 40
4: 235
Right 1042508103 8:69582748-69582770 CAAGGAAAGCACGGGGCTTGAGG No data
1042508096_1042508104 21 Left 1042508096 8:69582726-69582748 CCCGTAGGGATGAGGAGGAGGCC 0: 1
1: 0
2: 1
3: 40
4: 235
Right 1042508104 8:69582770-69582792 GCTGTTAAGTGCAAGCTTTTTGG No data
1042508096_1042508100 -9 Left 1042508096 8:69582726-69582748 CCCGTAGGGATGAGGAGGAGGCC 0: 1
1: 0
2: 1
3: 40
4: 235
Right 1042508100 8:69582740-69582762 GAGGAGGCCAAGGAAAGCACGGG No data
1042508096_1042508101 -8 Left 1042508096 8:69582726-69582748 CCCGTAGGGATGAGGAGGAGGCC 0: 1
1: 0
2: 1
3: 40
4: 235
Right 1042508101 8:69582741-69582763 AGGAGGCCAAGGAAAGCACGGGG No data
1042508096_1042508099 -10 Left 1042508096 8:69582726-69582748 CCCGTAGGGATGAGGAGGAGGCC 0: 1
1: 0
2: 1
3: 40
4: 235
Right 1042508099 8:69582739-69582761 GGAGGAGGCCAAGGAAAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042508096 Original CRISPR GGCCTCCTCCTCATCCCTAC GGG (reversed) Intronic
900167095 1:1248193-1248215 GGCCTCCCACTCCACCCTACAGG + Intergenic
900167138 1:1248324-1248346 GGCCTCCCCCTCTGCCCTACAGG + Intergenic
900167200 1:1248522-1248544 GGCCTCCCACTCTGCCCTACAGG + Intergenic
900167239 1:1248654-1248676 GGCCTCCCACTCTGCCCTACAGG + Intergenic
900167260 1:1248720-1248742 GGCCTCCCACTCCGCCCTACAGG + Intergenic
900167283 1:1248786-1248808 GGCCTCCCACTCTGCCCTACAGG + Intergenic
900167322 1:1248918-1248940 GGCCTCCCACTCCGCCCTACAGG + Intergenic
900167345 1:1248984-1249006 GGCCTCCCACTCCGCCCTACAGG + Intergenic
900167368 1:1249050-1249072 GGCCTCCCACTCCGCCCTACAGG + Intergenic
900167392 1:1249116-1249138 GGCCTCCCACTCCGCCCTACAGG + Intergenic
900167416 1:1249182-1249204 GGCCTCCCACTCCGCCCTACAGG + Intergenic
900167440 1:1249248-1249270 GGCCTCCCACTCCGCCCTACAGG + Intergenic
900167464 1:1249314-1249336 GGCCTCCCACTCCGCCCTACAGG + Intergenic
900167488 1:1249380-1249402 GGCCTCCCACTCCGCCCTACAGG + Intergenic
900167512 1:1249446-1249468 GGCCTCCCACTCCGCCCTACAGG + Intergenic
900167536 1:1249512-1249534 GGCCTCCCACTCCGCCCTACAGG + Intergenic
900167560 1:1249578-1249600 GGCCTCCCACTCCGCCCTACAGG + Intergenic
900167583 1:1249644-1249666 GGCCTCCCCCTCTGCCCTACAGG + Intergenic
900325868 1:2108391-2108413 GGCCACGTCCTCATCCCCTCTGG + Intronic
900526520 1:3131863-3131885 GCCTTCCTCCTCCTCCCTCCTGG + Intronic
901434720 1:9240145-9240167 GGCCTTTTCCACCTCCCTACAGG + Intronic
902568937 1:17334051-17334073 GCCCACCTCCTAATCCCTGCAGG + Intronic
902828973 1:18997491-18997513 GCCCTCCTGCTCACCCCTCCTGG + Intergenic
904624345 1:31793693-31793715 GGCCTCCCCCTCAACCCTGCTGG + Intronic
905397693 1:37677630-37677652 GTCCTCCTCCCCATCCTTCCTGG - Intergenic
905770798 1:40636810-40636832 GGCCTCCCCCTCAGCCTTGCAGG + Intronic
906142269 1:43540792-43540814 GGCCTCACCCTCTTCCCCACAGG + Intronic
906198498 1:43944775-43944797 GGGCTCCTCCTCATCCCTGGAGG - Intergenic
907309881 1:53533255-53533277 GGCCTTCTCCCCATGCCTCCAGG + Intronic
910263966 1:85318791-85318813 GGCCATCTCCTCATCTCTAAGGG - Exonic
910632402 1:89369524-89369546 AGCTTCCTCCTCTTCCCTGCAGG + Exonic
913300967 1:117367900-117367922 AGCCTCCTCTTCATTCCTAGGGG - Exonic
914428323 1:147599336-147599358 GGCCACCTCCTCACACCTTCGGG - Intronic
915638126 1:157200524-157200546 GGCCTCATCCTGATCCCTTGTGG + Intergenic
916181102 1:162084501-162084523 GGCCTCCTCCACCTCCTTGCTGG - Intronic
916343689 1:163764299-163764321 CCCCTCGTCCTCATCCCAACAGG - Intergenic
916496951 1:165355484-165355506 GGCCTCCTTCTCCTCGCTGCTGG - Exonic
916503836 1:165409690-165409712 GACCTCCTCCTTATCCTTGCAGG - Exonic
919878972 1:201889668-201889690 GGCCTCCTCTTCCTCCCTCCCGG + Intronic
920005675 1:202832156-202832178 GGCCTCATTCTCATGTCTACAGG + Intergenic
1062774669 10:135402-135424 CGCCTCCTCCTCCTCCCTGCCGG - Intronic
1062906621 10:1183856-1183878 GGCCCCATCCTCTTCCCTCCTGG - Intronic
1063383320 10:5600420-5600442 GCCCTCCTGCCCATCCCTCCCGG + Intergenic
1064179600 10:13102614-13102636 TGCCTCCTCTCCATCCCCACAGG - Intronic
1066566387 10:36725826-36725848 AGCCTCCTCATCATTCCTAAAGG + Intergenic
1067803855 10:49379958-49379980 GCCTTCCTCCTCATCCCCTCTGG - Intronic
1068903702 10:62299063-62299085 GGCCTCTTCTTCAACCCTAAGGG + Intergenic
1071100874 10:82036290-82036312 GGCCTCCCCTTCATCACTGCAGG - Intronic
1072536762 10:96370146-96370168 GGCCTCCTCCTCAACCTCAAAGG + Exonic
1072659898 10:97357282-97357304 GGCCCCCTTCTCATCCCTGCTGG - Intronic
1076286013 10:129297001-129297023 AGCCTCCTCCCCATCCCTGCAGG - Intergenic
1076286115 10:129298115-129298137 AGCCTCCTCCCCATCCCTGCAGG - Intergenic
1076695239 10:132244189-132244211 GGCCTCCTCATCAGGCCTGCAGG - Intronic
1077319374 11:1934342-1934364 GGCATCCTCCTCCTCCCTTCTGG - Exonic
1078567117 11:12425703-12425725 TCCCTCCGCCCCATCCCTACAGG - Intronic
1080602134 11:33830267-33830289 GGCCTCCAGGGCATCCCTACAGG - Intergenic
1084038688 11:66529361-66529383 TGCCTCCTGCTCATCTCCACAGG - Intronic
1085311767 11:75521046-75521068 GGTCTCCTCCTCCTCCCTCCAGG + Intronic
1087607592 11:100395137-100395159 GGCCTTCTCCCCATCCTTAGAGG - Intergenic
1088812456 11:113400818-113400840 GGCCTCCTCCTCCTCCTTTATGG + Intergenic
1088814262 11:113410605-113410627 GGCCTCCTCTTCACCCCGGCAGG - Exonic
1091069983 11:132553987-132554009 GGCCAGCTCCTCATCACTCCTGG - Intronic
1091392368 12:133441-133463 GGCCTCCTCAGCCTCCCTCCTGG - Intronic
1092195739 12:6548715-6548737 GCTCTCCTCCTCATCCCCATCGG + Exonic
1094395299 12:29998925-29998947 TGCCTCCTCCCCATCACAACAGG - Intergenic
1096489067 12:52003764-52003786 GTCCCCCTCCTCCTCCCTCCAGG - Intergenic
1096647575 12:53047143-53047165 CTCCTCCTCCTCCTCCCTCCCGG - Intronic
1098677950 12:73315292-73315314 GGCTTCCTCCTCAGCTCTAGGGG + Intergenic
1107092331 13:36495376-36495398 GGCCCCCTCCTCAACACTCCTGG - Intergenic
1112805938 13:103163856-103163878 GGCTTCCTCCCCATGCCTAAAGG + Intergenic
1113821966 13:113221071-113221093 CGCATCCTCCCCATCCCTTCAGG - Intronic
1113925677 13:113940227-113940249 GGCCTCCTGCTCTTCGCTTCCGG - Intergenic
1115332517 14:32213342-32213364 GGCCTCCTCCTCCTCTCTCATGG + Intergenic
1115775867 14:36714475-36714497 GGCCTCTTCCTTATCCCTCAAGG + Intronic
1119435490 14:74595321-74595343 GTCTTCCTCCTCATGCCTGCTGG - Intronic
1121278658 14:92685129-92685151 GGCCTCCCGCTCCTCCGTACAGG + Exonic
1121283091 14:92713573-92713595 GGCCCCCTCCGCAGACCTACTGG + Intronic
1122230388 14:100303977-100303999 TGCCTCCCCCTCTCCCCTACTGG - Intronic
1122297276 14:100712636-100712658 TGCCTCCTCCCCAGCCCTCCTGG - Intergenic
1122470782 14:101964649-101964671 GGCCGCCTTCTCATCGCTCCTGG + Exonic
1122822213 14:104353341-104353363 GGCCTCCTCCTCAGGCCTCCTGG - Intergenic
1123401021 15:19986656-19986678 GGCCTCCTCCTCAGGATTACAGG - Intergenic
1123847528 15:24317550-24317572 GGCCTCCTCCACATTCCTCAAGG - Intergenic
1124574293 15:30894489-30894511 AGCCTCCTCATCATTCCTAAAGG - Intergenic
1127730966 15:61801659-61801681 GCCCTCCTCCTCATGCTTCCAGG + Intergenic
1128082332 15:64864128-64864150 GGCCTCCTGCCCAGCCCTGCTGG + Intronic
1128451143 15:67806624-67806646 AGCCTCCTCCTCTTCCCCGCAGG + Exonic
1128581228 15:68811498-68811520 GGCCTCCACCCCTTCCCTCCCGG - Intronic
1128737778 15:70062986-70063008 TACCTCATCCTCATCCCTATTGG - Intronic
1130267539 15:82421591-82421613 GTCCTCCTCCTCATTCCTGGTGG - Intergenic
1130504486 15:84525243-84525265 GTCCTCCTCCTCATTCCTGGTGG + Intergenic
1130698739 15:86157519-86157541 AGCCACCTCCTCATACCCACAGG - Intronic
1130944718 15:88542228-88542250 AGCTTCCTCCTCAGGCCTACCGG - Intronic
1131177339 15:90218299-90218321 GGACTCATCATCATCCCTAGAGG + Intronic
1132329728 15:101003885-101003907 GACCTCCCCCGCCTCCCTACTGG - Intronic
1132525410 16:411729-411751 CGCCTCCTGCTCAGCCCCACTGG - Intronic
1132694697 16:1196658-1196680 GGCCCCCTCCTCACACCTGCTGG - Intronic
1132870195 16:2112446-2112468 GGCCTGCTCCCCATCCCCAAAGG + Exonic
1133013032 16:2925382-2925404 GCCCTCATCCTCATCCTTCCTGG + Intronic
1133818564 16:9216439-9216461 TCCCTCCTCCTCACCCCTCCAGG + Intergenic
1134522348 16:14924510-14924532 GGCCTGCTCCCCATCCCCAAAGG - Intronic
1134710018 16:16323161-16323183 GGCCTGCTCCCCATCCCCAAAGG - Intergenic
1134717233 16:16363161-16363183 GGCCTGCTCCCCATCCCCAAAGG - Intergenic
1134844551 16:17428935-17428957 TGCATCCTCCTGATCCCTATGGG - Intronic
1134949585 16:18345484-18345506 GGCCTGCTCCCCATCCCCAAAGG + Intergenic
1134957518 16:18388998-18389020 GGCCTGCTCCCCATCCCCAAAGG + Intergenic
1136274525 16:29170612-29170634 CTCCTCCTCCTCATCCCATCCGG + Intergenic
1138605678 16:58086677-58086699 GGCCCCCTCATCCTCCCTCCAGG - Intergenic
1142078812 16:88136266-88136288 CTCCTCCTCCTCATCCCATCTGG + Intergenic
1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG + Intronic
1142597092 17:1035239-1035261 GGACCCCTCCTCATCTCTGCTGG + Intronic
1143583183 17:7838266-7838288 GGCTCCCTCCTCCTCCCTTCCGG - Intergenic
1145743400 17:27294557-27294579 GGCTTCCTCCTCCTCGCTAGTGG - Intronic
1145898202 17:28473149-28473171 GTCCTCCTCCTCCTCCTTCCAGG - Intronic
1147579061 17:41618343-41618365 TGCCTCCACCTCATCACTGCTGG - Intergenic
1147793215 17:43025747-43025769 GACCTCCTCCTGTTCCCTTCTGG - Intronic
1148323185 17:46769693-46769715 GGCCCCCACCTCACCCCTTCCGG - Intronic
1148618500 17:49017015-49017037 CCCCGCCTCCTTATCCCTACAGG - Intronic
1148674056 17:49434838-49434860 AGCCCCCGCCTCATCCCTTCTGG - Intronic
1148753420 17:49959321-49959343 GTCCTCCTCCTCCTCCCTGGAGG + Intergenic
1149997979 17:61414851-61414873 TGCCTGCTCCTCAGCCCGACAGG + Intergenic
1150177161 17:63070473-63070495 AGCCGCCTTCTCATCCTTACTGG + Intronic
1150433436 17:65137169-65137191 GTCCTCCTCCTCCTCCCGCCAGG + Intergenic
1151086210 17:71384046-71384068 TCCCTCCTCCCCATCCCCACAGG - Intergenic
1153179149 18:2413463-2413485 GGCCTCCTCCTATTTCCCACTGG + Intergenic
1153667731 18:7381366-7381388 GGCCTACACCTCCTCCCTACTGG - Intergenic
1153893680 18:9540573-9540595 AGCCTCCTACTGATCCCTGCAGG + Intergenic
1159694798 18:71542487-71542509 GAATGCCTCCTCATCCCTACAGG + Intergenic
1160983265 19:1826412-1826434 TGCCTCCTCCTCATCCCCTCCGG - Intronic
1161169325 19:2805133-2805155 GGCCTCCTCCACTTTCCTCCTGG - Exonic
1163008591 19:14411172-14411194 GGTTTCCTCCTCATCCCCATAGG - Exonic
1163314455 19:16532536-16532558 GCGCTCCTCCTCAACCCTCCTGG - Intronic
1165061999 19:33209373-33209395 GGCGTCATCATCATCCTTACGGG - Exonic
1166531730 19:43546932-43546954 GGCCTCATCCTCCTCACTGCTGG + Exonic
1167234261 19:48304125-48304147 GGCCTTCGCCTCCTCCCTGCGGG + Exonic
1167413122 19:49356613-49356635 GGCCTCCTCTTCATCTCCGCTGG - Intronic
1167416262 19:49374721-49374743 GGCCTCCTTCTCCTCCATCCTGG - Exonic
1167456894 19:49601127-49601149 GGCCTCATCCTCCTCCCTCCAGG - Intronic
1168252404 19:55148099-55148121 TGCCTCTTCCTAATCCCAACTGG - Intronic
1168255929 19:55165314-55165336 GGTCTCCTCCCCCTCCCTAGAGG - Intronic
925289973 2:2740850-2740872 AGCCTCCTCCTCACTCCTACAGG - Intergenic
925903913 2:8527813-8527835 GGCCGCCTCCAAATCCCTGCTGG + Intergenic
928370732 2:30738353-30738375 GGCCCCATCCTCCTCCCTGCTGG - Intronic
929883961 2:45862311-45862333 TGCCTCCTCCTCATCCGTCCAGG + Intronic
929922127 2:46180170-46180192 GGAACCCTCCTCATCCCTCCAGG - Intronic
932770479 2:74498318-74498340 GACCCCCTCCCTATCCCTACAGG - Exonic
932863620 2:75319184-75319206 GGCCTCCACCACTTCCTTACTGG + Intergenic
934763252 2:96867748-96867770 GACTTCCTCCTCACCCCTCCAGG + Intronic
934913648 2:98280575-98280597 GGCCTCAGCCTCATCCCAGCTGG - Intronic
937275127 2:120679232-120679254 GGCCTCCTCTGCACCCCCACCGG - Intergenic
937418919 2:121738694-121738716 GGCCTCCACCTCAGGCCCACAGG - Intronic
937875362 2:126821127-126821149 GGCCTCCAGCTCCTCCCTCCTGG - Intergenic
939655452 2:144818761-144818783 GGCCTCCTCCTCATTTAAACTGG + Intergenic
941092493 2:161194508-161194530 GGCCTTCTCTTCAGCCTTACTGG - Intronic
946213719 2:218167366-218167388 GTCCTCCTCCTCTTTCCCACTGG - Intergenic
947331765 2:229036291-229036313 GTCCTACTCCTCAGCCCTACAGG + Intronic
947530992 2:230908521-230908543 TTCCTCCTCCTCCTCCCCACAGG + Exonic
947548934 2:231032810-231032832 GTTCTCCTCCTCACCCCTACTGG + Intergenic
948043405 2:234923180-234923202 GGTCTCCTCCTGTTCCCTCCTGG - Intergenic
948094324 2:235321453-235321475 TGGCTCCTTCTCATCCCTCCTGG + Intergenic
948140721 2:235670296-235670318 GGCCTCCTCCTCAAGCCTCCCGG - Intronic
948360161 2:237414221-237414243 CTCCTCCTCCTCCTCCCTCCCGG + Exonic
948665093 2:239529650-239529672 GGCCTCCTCCAAATCCCCACGGG + Intergenic
948888090 2:240893802-240893824 GGCCTCCTGCTCACCCCAATGGG + Intronic
1170248204 20:14247853-14247875 GAATTCCTCCTCATCCCTATAGG + Intronic
1170456282 20:16536856-16536878 GGCCTTCTCTTCACCCCTAGGGG + Intronic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1172514489 20:35523495-35523517 GGCCACCTACTGATCACTACTGG + Intronic
1172940372 20:38649877-38649899 TGCCTCCTCCTCTCCCCTGCTGG + Exonic
1173918249 20:46725577-46725599 AGCCTCCTCTTCCTCCCTGCTGG + Exonic
1174067160 20:47873829-47873851 TGCTTCATCCTCATCCCTGCTGG - Intergenic
1174293377 20:49525031-49525053 GGCCTCCTCCTCATGCACATGGG - Intronic
1175263861 20:57691005-57691027 TGCCTCCTCCTCGTCCCTACCGG + Intronic
1178865040 21:36320216-36320238 GGCCTCCGCCGCAACCCGACTGG - Exonic
1180183507 21:46128438-46128460 GGCATCCTCCTCGGCCCTCCTGG + Intronic
1180191847 21:46169258-46169280 GGGCTCCTCCTCATCCACAGAGG - Intronic
1181033633 22:20159690-20159712 GGCCCCCTCCTGATCACTCCTGG - Intergenic
1181169227 22:20998883-20998905 AGCCTCCTCCAAATCCCTCCTGG + Exonic
1181509676 22:23383555-23383577 GGCCCCCTCCTGATCACTCCTGG + Intergenic
1182515400 22:30855945-30855967 GGTTTCTTCCTCATCCCTGCAGG + Intronic
1182991426 22:34771477-34771499 GTCTTCCTCCCCATCCCCACTGG - Intergenic
1185116851 22:48942750-48942772 GGCCTCCCCTCCATCCCTCCTGG + Intergenic
1185117901 22:48948599-48948621 CCCCTCCTCCTCATCTCTGCAGG - Intergenic
949980961 3:9501444-9501466 GGCCTCCTCTTCCTCTCTGCTGG - Exonic
952738164 3:36710598-36710620 GGCCTCCTGCTCATTCTCACTGG + Intergenic
953243884 3:41173668-41173690 GGCCTCCTCGTCATACCCATTGG - Intergenic
953811991 3:46120766-46120788 GGCCTCATCCTCCACCCTACAGG - Intergenic
954335087 3:49911698-49911720 GGCATCCTCCTCATCCCCCTCGG + Exonic
954361735 3:50125842-50125864 GGCCTCCTCCTCACTGCCACAGG - Intergenic
955117475 3:56020078-56020100 CTCCTCCTCCTCATTACTACTGG - Intronic
960316094 3:116179060-116179082 GGCCTCCTCCTCCTTCCTGCAGG + Intronic
961369169 3:126419069-126419091 GGTCTCCTTCTCAGCCCTAGGGG - Exonic
961502373 3:127345872-127345894 GGCCTCCTCCTCTTACCCATGGG + Intergenic
966729921 3:183142221-183142243 GGCCCCCGCCCCATCCCTAAGGG + Intronic
968930411 4:3575897-3575919 GGCCTCCTCCTGTTCCTGACAGG + Intergenic
969492053 4:7505057-7505079 GTCCTGCTCCCCATCCCTCCCGG - Intronic
969968469 4:11021496-11021518 GGCCTCCTCCAGTTCCCCACGGG + Intergenic
979606063 4:122640291-122640313 GGGCTACTCCTCATCTCTGCTGG - Intergenic
984951957 4:185014664-185014686 GCCCTCCTCCTCAGCCCTGGAGG + Intergenic
985382212 4:189406426-189406448 TGCCTCCTCCTCTTCTCTTCTGG + Intergenic
985657333 5:1139130-1139152 GGCTCCCTCCTCATCCCCATGGG + Intergenic
987062825 5:14258700-14258722 GGCCTCCTCCTGCTTGCTACTGG - Intronic
987073634 5:14360464-14360486 GGCCTCCTCCACATACCTCTGGG + Intronic
988255144 5:28810074-28810096 GGCCTCCTCCTCCTCCCAGAGGG - Intergenic
991676430 5:69093766-69093788 GCCCTCCCCCTCTGCCCTACAGG + Exonic
992197250 5:74352096-74352118 CCCATCCTCCTCATCCCCACTGG - Intergenic
993424786 5:87749544-87749566 GGCCTCCTTCTGAGCCCTACTGG + Intergenic
993635902 5:90343457-90343479 TACCTCCTCCTCATCCCTCAGGG - Intergenic
994181783 5:96775659-96775681 TGCTCCCTCCTCATCCCTTCAGG - Intronic
994732991 5:103516407-103516429 CGCCTCCTGATCATCCCCACTGG + Intergenic
996298533 5:121954080-121954102 GGCCTCGGCCTCCTCCCTGCGGG - Intergenic
999370935 5:151054902-151054924 GGCCTGCTCCTAGTCCCTAAGGG + Intronic
1001446694 5:171790726-171790748 ACCCTCCTCCCCATCCCCACTGG - Intronic
1002066543 5:176654746-176654768 GGCCACCTCCCCACCCCCACAGG - Intronic
1002434381 5:179221884-179221906 GGCCTGCTCCTCAGCCCCATGGG - Intronic
1003964876 6:11243191-11243213 GGCCTCCTGCTCAGTCCTCCAGG + Intronic
1004607358 6:17206604-17206626 GGCCTCAGCCTCCTCCCCACAGG - Intergenic
1006422426 6:33943643-33943665 GACCAGCTCCTCATCCCAACGGG + Intergenic
1006903557 6:37518214-37518236 GGCCTCCTGTTCATCCATGCTGG - Intergenic
1007059388 6:38923751-38923773 GGCTTCCTCCTGAAGCCTACAGG - Intronic
1007472419 6:42099480-42099502 GGCCTCTGCCTCACCCCTCCAGG + Intergenic
1010521088 6:76838435-76838457 TGCCTCCTCCTCACTCCCACAGG - Intergenic
1013236116 6:108198961-108198983 CACCTCCTCCGCATCCCTACAGG - Intergenic
1013448354 6:110253930-110253952 GCCATCCTCCTCACCCCTCCTGG - Intronic
1014908241 6:127057053-127057075 GAATGCCTCCTCATCCCTACAGG - Intergenic
1017493723 6:154966231-154966253 GGCCCCCTCCACCTCCCTCCCGG + Intronic
1017674348 6:156797868-156797890 TGGCTCCTCTTCATCCCTAAAGG - Intronic
1019477690 7:1251893-1251915 GGCCCCCTCCTCGTGCCTAGGGG - Intergenic
1023222061 7:37929740-37929762 GCCCTCCACTTCAACCCTACTGG - Intronic
1027162631 7:75813642-75813664 GCCCACCACATCATCCCTACGGG - Exonic
1027236789 7:76303092-76303114 AGCCTCCTCCTCTCCCCTGCAGG - Intronic
1029524719 7:101087773-101087795 GGCCTCCTCATCATACCACCCGG - Exonic
1029656217 7:101926475-101926497 GGCAACCTCCTCTTCCCTACAGG - Intronic
1030077026 7:105745709-105745731 GGCCTCCTGCCCCTCCCAACAGG - Intronic
1031527740 7:122841989-122842011 GGCCTGCTTCCCATCCCTAATGG - Intronic
1032851797 7:135801673-135801695 GCCGTGCCCCTCATCCCTACAGG + Intergenic
1033269578 7:139918637-139918659 GGCTTCCTCCTCCTCCCCAGTGG + Intronic
1034228956 7:149504382-149504404 GACCACTTCCACATCCCTACTGG + Intergenic
1036259329 8:7227991-7228013 GTCCTCCTCCTCCTCCCTTCTGG + Intergenic
1036311371 8:7686561-7686583 GTCCTCCTCCTCCTCCCTTCTGG + Intergenic
1036683056 8:10890017-10890039 CGCCTCCTGCTCATTCCTAGCGG - Intergenic
1037813406 8:22099548-22099570 GGCCTCCTACCCTTCCCTGCAGG + Intronic
1037882855 8:22581357-22581379 TGCCAGCTCCTCATCCCTACAGG + Exonic
1042508096 8:69582726-69582748 GGCCTCCTCCTCATCCCTACGGG - Intronic
1050461248 9:5879483-5879505 TGCCTCCTTTTCATCCCTAAAGG + Intergenic
1050663627 9:7910893-7910915 GGCCTCTTCCTCTACTCTACTGG - Intergenic
1052932181 9:34064774-34064796 TGCCTTCTCCTCCTCCCCACTGG + Intergenic
1053130998 9:35615706-35615728 GCCATCCTCCTCTCCCCTACAGG + Intronic
1053575840 9:39357135-39357157 GGCCTCCGCCTCCGCCCTACTGG - Exonic
1053840356 9:42185072-42185094 GGCCTCCGCCTCCGCCCTACTGG - Exonic
1054097408 9:60915826-60915848 GGCCTCCGCCTCCGCCCTACTGG - Intergenic
1054118813 9:61191456-61191478 GGCCTCCGCCTCCGCCCTACTGG - Exonic
1054459697 9:65456017-65456039 GGCCTCCTCCTGTTCCTGACAGG - Intergenic
1054588941 9:66991106-66991128 GGCCTCCGCCTCCGCCCTACTGG + Intergenic
1055986948 9:82062268-82062290 GGCCTCCCCCTCTGCCCTACTGG + Intergenic
1056612421 9:88133626-88133648 GGCCTCCCCCTCCGCCCTGCTGG + Intergenic
1056824388 9:89866384-89866406 GGCCCCCTCTTCATCACAACTGG - Intergenic
1056912817 9:90718829-90718851 GGCCAGCTCCTCACCCCTAGAGG - Intergenic
1057080711 9:92172578-92172600 GGCCTCCTCCTCCTGCATATGGG - Intergenic
1057160230 9:92883945-92883967 GGCATCCCCCTCTGCCCTACTGG - Intergenic
1057207469 9:93182303-93182325 GGCCTCCTCCTGCTCCCAACAGG - Intergenic
1057962168 9:99467333-99467355 GGCCTCCAGATCATCCCTTCTGG + Intergenic
1060190286 9:121588415-121588437 CCCGTCCTCCTCATCCCAACTGG + Intronic
1060224670 9:121783695-121783717 GGCCTCCTCCTCACCCTTCCCGG + Exonic
1060888788 9:127175150-127175172 GGCATCCTCCGCACCCCTCCAGG - Intronic
1061368520 9:130185155-130185177 GGCCTCCTCCTCAGTCCTGGTGG + Intronic
1061484110 9:130911737-130911759 GGCCTCCTCCCCCTGCCTTCCGG - Intronic
1061985155 9:134126372-134126394 GGGCTCCTCCCCAGACCTACCGG + Intergenic
1061999564 9:134209116-134209138 TGCCTTCTCCTCATCCCTTCCGG + Intergenic
1062200857 9:135301972-135301994 GGCCTCCTGCTCCTCCCCACAGG + Intergenic
1062303108 9:135886939-135886961 GCCCTCCTCCTCCACACTACTGG - Intronic
1186671600 X:11772521-11772543 GGGCCCCTCCTTATCTCTACTGG - Intronic
1187828211 X:23354196-23354218 TACCTCCTCCTCATCCATGCTGG - Intronic
1190452886 X:50598425-50598447 GGCCTCCACCTCCTCCCCAAGGG + Exonic
1193132672 X:77934078-77934100 GAATGCCTCCTCATCCCTACAGG - Intronic
1197252546 X:124230480-124230502 GCCCTCCTCCACCTCCATACGGG - Intronic
1199767968 X:150954207-150954229 GGCTTCCTCCTCATGCCCACTGG - Intergenic