ID: 1042511592

View in Genome Browser
Species Human (GRCh38)
Location 8:69617982-69618004
Sequence GATTCCATGGGGAAGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 361}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042511592_1042511600 23 Left 1042511592 8:69617982-69618004 CCTCCTGCCTTCCCCATGGAATC 0: 1
1: 0
2: 4
3: 29
4: 361
Right 1042511600 8:69618028-69618050 CAGTTGCTAATGTAAAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042511592 Original CRISPR GATTCCATGGGGAAGGCAGG AGG (reversed) Intronic
900304910 1:2000972-2000994 GGTTCCCTGGGTAGGGCAGGTGG + Intronic
900695616 1:4008029-4008051 GATGCCATGGGGAAGGAACTGGG + Intergenic
900798344 1:4723018-4723040 CATTCTAGGGGGAAGACAGGAGG + Intronic
900908956 1:5580547-5580569 GATCCCTTGGGAAAGGCTGGGGG + Intergenic
901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG + Intronic
901536141 1:9883981-9884003 GAATCCATGGGGAAGGAGGAAGG + Intronic
904148603 1:28417063-28417085 CATTTCAGGGGGAAGGAAGGGGG - Intronic
904349221 1:29894063-29894085 GAGCCCATGGGGGATGCAGGAGG + Intergenic
904993115 1:34609922-34609944 GATTCCAGGCAGAGGGCAGGGGG + Intergenic
905811061 1:40913558-40913580 GCTTCCAGGGCCAAGGCAGGAGG - Intergenic
907251011 1:53139472-53139494 GGTTCCTTGGGGCAGGCAGTGGG + Intronic
909620657 1:77663016-77663038 GATTGCCTGGGGCTGGCAGGTGG + Intronic
909789680 1:79659916-79659938 CATTCCATGGGGCAGGCCAGGGG + Intergenic
912432930 1:109639048-109639070 GAAGCCATCAGGAAGGCAGGAGG - Intergenic
914240639 1:145850464-145850486 GCTCCCAGTGGGAAGGCAGGTGG + Exonic
914915522 1:151816800-151816822 GAAGCCCTGGGGAAAGCAGGTGG + Exonic
914967922 1:152277783-152277805 GTTTCCAGGTGGAAGGCAAGAGG - Intergenic
915913501 1:159928449-159928471 GATTCCCTGGGGGATACAGGAGG + Exonic
917238439 1:172919857-172919879 GATTCCATGGGCAGTGGAGGAGG - Intergenic
917268453 1:173246993-173247015 GATTCCCTGGGAAAAGAAGGAGG - Intergenic
917454838 1:175177357-175177379 GATGCCATAGGGATGGCAGTTGG + Intronic
917730875 1:177873385-177873407 GGAGCCACGGGGAAGGCAGGCGG - Intergenic
919827659 1:201515013-201515035 GACTCCAAGGGGCAGACAGGAGG + Intergenic
920393506 1:205626525-205626547 AATTGCAAGGGGAAGGTAGGAGG + Intronic
922098456 1:222462254-222462276 GATTCTATGGGGAAGGGGAGAGG + Intergenic
922748862 1:228061528-228061550 AATTCCATGGGGAAGGAATAAGG + Intergenic
923650310 1:235867107-235867129 GAGCCAATAGGGAAGGCAGGGGG + Intronic
923788407 1:237090386-237090408 GATTACATGAGGGAGGCAGGGGG + Intronic
1063537177 10:6894692-6894714 TGTTCCATAGGGAAGGCAGGAGG + Intergenic
1064295556 10:14076200-14076222 GGTAACATGGGAAAGGCAGGTGG - Intronic
1065634512 10:27716970-27716992 TTTTCCTGGGGGAAGGCAGGGGG + Intronic
1067229540 10:44396881-44396903 GGCTCCATGGAGAAGGCTGGTGG + Intergenic
1070313293 10:75289002-75289024 GTTACCATGGGGAAGGCTGGAGG + Intergenic
1070756397 10:78996124-78996146 TCTTCCAGGGGGAAGGCTGGTGG - Intergenic
1070840985 10:79487764-79487786 GACACCAGGGGGAAGGCAAGTGG - Intergenic
1070845153 10:79516001-79516023 GATTTTATGGGGAAAGCAGCTGG + Exonic
1070928644 10:80244307-80244329 GATTTTATGGGGAAAGCAGCTGG - Intergenic
1072458859 10:95601393-95601415 GATCCCATACTGAAGGCAGGAGG - Intergenic
1072693924 10:97589470-97589492 GATTCCAAGCAGAAGGCAGAAGG + Intronic
1073125605 10:101146963-101146985 AACTCCAGGGGGATGGCAGGGGG - Intergenic
1073206850 10:101774216-101774238 CATTCCCTGGGGAACCCAGGCGG - Intronic
1073378079 10:103054175-103054197 GATGCCACGGGGAAGGAGGGAGG - Intronic
1073562576 10:104509529-104509551 GTTTCCATGGGCCAGGCATGAGG - Intergenic
1074820595 10:117175397-117175419 GATGCTAGCGGGAAGGCAGGAGG - Intergenic
1074941252 10:118237625-118237647 GATTGGGTGGGGAAGGTAGGAGG + Intergenic
1075639614 10:124055533-124055555 GATGCCCTGGAAAAGGCAGGTGG + Intronic
1075934855 10:126331712-126331734 GACCGCATGGGGAAGGAAGGAGG + Intronic
1075982138 10:126749275-126749297 TCTTCCATGGGGCAGGTAGGAGG - Intergenic
1076519294 10:131070730-131070752 CACTCCATGGGCAAGGCTGGGGG + Intergenic
1076597429 10:131632956-131632978 GAGGCCTTGGGGAAGGCAGGAGG - Intergenic
1076704285 10:132292902-132292924 GTCTGCATGGGGAAGGGAGGGGG - Intronic
1077646769 11:3932252-3932274 ACTTCCATAGGGAAGGCAGCAGG - Intronic
1077994457 11:7441516-7441538 GATTCCATGGTTAAGGATGGGGG + Intronic
1078196108 11:9138400-9138422 GCTTTCCTGGGGATGGCAGGTGG - Intergenic
1078387658 11:10907062-10907084 CATTTCATGGGGAGGGCGGGAGG + Intergenic
1079314428 11:19395747-19395769 GAGACCATGAGGAAGGGAGGCGG - Intronic
1080467583 11:32512348-32512370 CAATCCATTGGGAAGGCTGGAGG - Intergenic
1081580591 11:44348961-44348983 GCCTCCATGGGGATGGCAGAGGG - Intergenic
1081856530 11:46307746-46307768 GCTCCCAGGGGGCAGGCAGGGGG + Intronic
1082794154 11:57368105-57368127 GAGTCCATGGGCCAGGCAGATGG + Intronic
1082820024 11:57538423-57538445 GACTTCCTGGGGAAGGAAGGAGG + Intergenic
1084523652 11:69682671-69682693 GACCCCATGGGGTAGGCAGGAGG + Intergenic
1084616976 11:70242955-70242977 CATTCCATGGGCAAGGCAGGAGG + Intergenic
1084878125 11:72149125-72149147 GACTCCTTGGGGAAAACAGGAGG + Intergenic
1085339317 11:75721005-75721027 GATAGGATGGGGAAGGCAGTGGG + Intronic
1085381476 11:76123181-76123203 GTTTCCCTGAGGAAGGTAGGAGG - Intronic
1085862549 11:80251620-80251642 GCTTACATGGGGAAGCCAGGAGG - Intergenic
1088599933 11:111464913-111464935 TGTTTGATGGGGAAGGCAGGGGG - Intergenic
1088771047 11:113036469-113036491 GAGTGCAGGGGCAAGGCAGGGGG - Intronic
1089069672 11:115689681-115689703 GGTTCCTTGGGGTAGGCTGGGGG + Intergenic
1089670514 11:120053849-120053871 GATTCTATGGGCAAGGAAGGAGG + Intergenic
1089789833 11:120934616-120934638 GTTTACAAGGGGAGGGCAGGCGG - Intronic
1090562295 11:127945505-127945527 GATTTCACTGGGAAGGCAAGAGG + Intergenic
1090666505 11:128918236-128918258 GATTGCCTGGGGAAGGCAAAGGG + Exonic
1091604303 12:1936979-1937001 GATTTCTTGGAGAAGGGAGGAGG + Intergenic
1091664633 12:2410358-2410380 GATTCCAGAGAGAAGGGAGGTGG - Intronic
1092140324 12:6179218-6179240 GAATGGATGGGGAAGGAAGGAGG - Intergenic
1094244170 12:28268723-28268745 GATGGCATGGGGAAGGGAGGAGG + Intronic
1095634845 12:44421006-44421028 AATGCCTGGGGGAAGGCAGGTGG + Intergenic
1096650125 12:53058475-53058497 GAGTCCAGGTGGCAGGCAGGTGG + Intronic
1100123696 12:91397740-91397762 CATCCCATGGAGAAGGCAGAAGG + Intergenic
1101188550 12:102307066-102307088 GATTCCTTGGGAAAAACAGGAGG + Intergenic
1102425210 12:112838555-112838577 GCATCCAAGGGGAAGGGAGGGGG + Intronic
1102574616 12:113848532-113848554 CATTCTAGGGGCAAGGCAGGTGG + Intronic
1102715444 12:114967821-114967843 GACTCCATGGGGAAAGCATTTGG - Intergenic
1103320083 12:120087317-120087339 GTTTCTCTAGGGAAGGCAGGCGG + Intronic
1103329543 12:120144589-120144611 GAGTCCTTGAGGAGGGCAGGAGG - Intronic
1103485429 12:121279689-121279711 GATTTCATGGGGAAGGATGCAGG - Intronic
1103941798 12:124505313-124505335 GAGTCCATGGGAGTGGCAGGGGG - Intronic
1104383662 12:128329740-128329762 GACCCCATGGAGAAGGCATGTGG + Intronic
1104800770 12:131554079-131554101 GGGTCCAGGGGGAAGGCAGAAGG + Intergenic
1105307109 13:19176803-19176825 TATTCCATGGGCTAGGCATGTGG - Intronic
1105704712 13:22961802-22961824 GACGCCATGGAGAAGCCAGGAGG + Intergenic
1105857668 13:24386850-24386872 GACGCCATGGAGAAGCCAGGAGG + Intergenic
1106200099 13:27528762-27528784 GGCTCCATGGAGAAGCCAGGTGG - Intergenic
1106826180 13:33523124-33523146 GAATCCATGGAGAAGTCAGGAGG - Intergenic
1108039782 13:46329421-46329443 GAGTCCAGGGGGAGGGTAGGGGG + Intergenic
1109656149 13:65393063-65393085 AGTTCCCTGGGGAAGGCAGCTGG + Intergenic
1111316439 13:86567186-86567208 GACTGCCTGGGGAAAGCAGGGGG + Intergenic
1112783550 13:102927658-102927680 GATTTCATCTGGAAGGCAAGGGG - Intergenic
1114332636 14:21652568-21652590 GCTTCTATTGGGAAGGAAGGTGG + Intergenic
1114764446 14:25355101-25355123 GATTCCTTGGGGAAAGGAGGTGG + Intergenic
1116586919 14:46717694-46717716 ATTACCATGGGGATGGCAGGAGG + Intergenic
1116678832 14:47939970-47939992 GACTCCATGGGAAAAACAGGAGG + Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119124304 14:72111372-72111394 CATTCCATGTGGAAGGGAAGTGG + Intronic
1119543803 14:75457536-75457558 GTTTCAATGGGGAAGGTATGAGG + Intronic
1122163319 14:99802384-99802406 GCTTCCAGGGGGAGGGCAGGTGG + Intronic
1122310158 14:100789209-100789231 GATTCCAGGGGGCAGCCAAGAGG - Intergenic
1122409580 14:101518981-101519003 GATCCCAGGGGGTAGGCACGAGG + Intergenic
1123112180 14:105878112-105878134 GCAACCATGGGGAAGGCAGGGGG + Intergenic
1123758168 15:23413118-23413140 GATTCCACCAGGAAGGCTGGGGG - Intergenic
1124798801 15:32809476-32809498 GATAGTATGGGGATGGCAGGAGG - Intronic
1125056663 15:35366581-35366603 GATTCTTTGGGGAAGGGAGCAGG - Intronic
1125502056 15:40245967-40245989 GAATGCAGGGGGATGGCAGGAGG - Intronic
1126427322 15:48542673-48542695 GGTTCCATGGGGAAAACTGGGGG - Intronic
1127122418 15:55783033-55783055 TTTTCCAAGGGGGAGGCAGGGGG + Intergenic
1127701373 15:61504741-61504763 GATGTCATGGGGAAGGAAGTGGG + Intergenic
1128707803 15:69850525-69850547 CCCTCCATGGGGGAGGCAGGAGG - Intergenic
1128910301 15:71507785-71507807 GCTTCCATGGGGAGGGCATGTGG - Intronic
1129326772 15:74803922-74803944 TATTCCCTGAGGCAGGCAGGTGG + Intergenic
1129683637 15:77672181-77672203 GAGTCCATGTGGAGGGGAGGTGG - Intronic
1130297778 15:82659382-82659404 GAATCCATGGGGAGGGCATTAGG + Intronic
1130956472 15:88630536-88630558 GACTCCATGGAGATGTCAGGTGG + Exonic
1134453255 16:14376252-14376274 GATTCCATGTTGATGGCAAGAGG - Intergenic
1134608109 16:15586959-15586981 GAGGCCATGGGCACGGCAGGCGG + Exonic
1134748209 16:16604298-16604320 GATGCTATGCAGAAGGCAGGAGG - Intergenic
1134997254 16:18749325-18749347 GATGCTATGCAGAAGGCAGGAGG + Intergenic
1135619545 16:23943898-23943920 GATCACATGGGGAAGGCACCAGG + Intronic
1135977390 16:27117764-27117786 GAATGCATGGGGAGGGGAGGAGG + Intergenic
1136449123 16:30342796-30342818 GAGACCTTGGGGAGGGCAGGTGG - Intergenic
1137905495 16:52318095-52318117 GCTTCCATGGTGAATGCAGAGGG - Intergenic
1138457930 16:57131983-57132005 GATTGCCTGGGGAAGGCACTGGG + Intronic
1138531665 16:57637787-57637809 GAGGCCATGGGAAAGGCAGCAGG - Intronic
1139203070 16:64998884-64998906 AATTCCATGAGGAAAGCAGTGGG + Intronic
1140875881 16:79152279-79152301 CATGCGATGGGGAATGCAGGTGG + Intronic
1141196265 16:81863865-81863887 GGTTGCAGGTGGAAGGCAGGTGG + Intronic
1141733996 16:85840274-85840296 GTCTCCATGGGAAAGGAAGGAGG - Intergenic
1143444813 17:7001412-7001434 GATGTCAGGTGGAAGGCAGGAGG - Intronic
1145057793 17:19714641-19714663 GGTGCCATGGAGATGGCAGGTGG - Intronic
1146351800 17:32101633-32101655 GATTCCCTGGGGAAGACACATGG - Intergenic
1146358142 17:32152406-32152428 GAGTCCATGGGAAAAGCAGAAGG + Intronic
1146597436 17:34182818-34182840 GAAGCCATTGGGAATGCAGGTGG - Intergenic
1147557757 17:41490232-41490254 GATCCCCAGGGGAAGGGAGGTGG - Intronic
1148739304 17:49883296-49883318 GCTTCCTTTGGGAAGGGAGGAGG + Intergenic
1149444811 17:56705305-56705327 GCATCCATGGGGAAGGCAGGTGG + Intergenic
1150623317 17:66824379-66824401 AATCCCATGGGGAAAGCTGGGGG + Intergenic
1151360376 17:73585041-73585063 TCTGCCATGGGGAAGTCAGGGGG + Intronic
1151697203 17:75723733-75723755 GATTCAATGGGGAGGGCCCGTGG + Intronic
1152275455 17:79354069-79354091 CATGTCATGGGGAGGGCAGGGGG - Intronic
1152656716 17:81523306-81523328 GGCTCCATCGGCAAGGCAGGGGG - Intronic
1152727373 17:81954267-81954289 GATCTCATGGGAGAGGCAGGCGG + Exonic
1153346349 18:4030504-4030526 GATTCCATGGGATGGGCTGGAGG - Intronic
1153979871 18:10299663-10299685 GAGTCCTTGGGGAATGGAGGAGG + Intergenic
1154930618 18:20991481-20991503 GATTCAAATGGGAAGGGAGGGGG - Intronic
1155642321 18:28033045-28033067 GATTCAATGGAAATGGCAGGTGG + Intronic
1156390885 18:36649486-36649508 GAGTCAATGAGGAAGGGAGGTGG - Intronic
1157140200 18:45098096-45098118 GATGGTTTGGGGAAGGCAGGGGG + Intergenic
1157886246 18:51369672-51369694 GATTGCATGGGGAAAGCATATGG - Intergenic
1158192461 18:54845610-54845632 TATTCCAGGGGGCAGTCAGGGGG - Intronic
1158423092 18:57313398-57313420 AATGTCATGGGGAAGGAAGGAGG + Intergenic
1158685706 18:59612408-59612430 GCTGCCTTGGGGAAGACAGGAGG - Intronic
1160792505 19:929189-929211 GCCTTCATGGGGAAGGAAGGAGG + Intronic
1162056974 19:8070618-8070640 GATTCCATGGATATGGCACGTGG - Intronic
1163166202 19:15499793-15499815 GATGCCTTTGGGCAGGCAGGTGG - Intergenic
1164288040 19:23839706-23839728 GAATCCATGGGAGAGGGAGGAGG - Intergenic
1164494413 19:28746290-28746312 GCTGGAATGGGGAAGGCAGGGGG - Intergenic
1165108496 19:33487958-33487980 GGTTCCCCGAGGAAGGCAGGTGG - Intronic
1165205514 19:34181915-34181937 GATTAGATGGGGAAGGCTGATGG - Intronic
1165361733 19:35341141-35341163 GAGTCCCTGGGCTAGGCAGGGGG + Intronic
1166658137 19:44627225-44627247 GCTTCCATGTGGTAGGAAGGTGG + Intronic
1166701800 19:44886371-44886393 GATTCCATGGGGGAGGTCAGGGG + Intronic
1167521674 19:49959313-49959335 GAGTCCATTGGGAGGGCAGAGGG - Intronic
1167523709 19:49971409-49971431 GAGTCCATTGGGAGGGCAGAGGG + Intergenic
1167698410 19:51027966-51027988 GAATCCAAGGGGTGGGCAGGAGG + Intronic
1167756358 19:51415851-51415873 GAGTCCATTGGGAGGGCAGAGGG - Intronic
1168077177 19:53987435-53987457 GAGTCAAAGGGGAAGGAAGGAGG + Exonic
1168127303 19:54292366-54292388 GGGTCCATGGGAAAGGCTGGTGG + Intergenic
1168173068 19:54602551-54602573 GGGTCCATGGGAAAGGCTGGTGG - Intronic
1168472381 19:56650008-56650030 GAGCCCATGTGGAAGGAAGGTGG + Intronic
1168569707 19:57456052-57456074 GAATCCATTGAGAAGGCAGATGG + Exonic
927558127 2:24049993-24050015 GGCTGGATGGGGAAGGCAGGCGG + Intronic
927836079 2:26400465-26400487 GATACCATGAGAAAGTCAGGGGG - Intergenic
929123726 2:38504125-38504147 CATTCCAGGGGGAAAGGAGGGGG + Intergenic
931450894 2:62366786-62366808 TATTCTATGGAGAAGGCAGGGGG - Intergenic
933071673 2:77866097-77866119 GATGCAGTGGAGAAGGCAGGAGG - Intergenic
933669259 2:84991241-84991263 ACTGACATGGGGAAGGCAGGAGG + Intronic
934969468 2:98751211-98751233 GATTCCATGGGAGAGACAGTGGG - Intergenic
935633405 2:105231139-105231161 GTTACCATGGGGCAGGCAGGAGG - Intergenic
935699759 2:105801358-105801380 GATGACATGGGGAAGGGGGGAGG - Intronic
936391928 2:112082886-112082908 GATTCCCTGAGGATGGCAGATGG - Intronic
936808958 2:116372679-116372701 GGTGCCATGGGGAAGTCATGGGG + Intergenic
937231046 2:120398425-120398447 CATTCTATGTGGGAGGCAGGAGG + Intergenic
937981721 2:127619788-127619810 GAGTCCATGGGGAAGGACGCAGG + Intronic
940967255 2:159852906-159852928 CATCCCAGGGTGAAGGCAGGAGG + Intronic
941005097 2:160239806-160239828 GACTCCATGGGAAAGAGAGGAGG + Intronic
941390449 2:164907170-164907192 GATTCCATTGGGAAGACAGGGGG - Intronic
942190170 2:173461844-173461866 GATTCCATGGGGAAGAACTGAGG - Intergenic
942202117 2:173581813-173581835 GATTCCCTGGGGAAGGGCTGGGG - Intergenic
942831936 2:180247020-180247042 GATTCGATTGAGAAGACAGGAGG - Intergenic
944676544 2:202037121-202037143 CATTTTCTGGGGAAGGCAGGAGG + Exonic
945033248 2:205684234-205684256 GAATCCATGGGGAATGCAGTGGG + Intronic
946020997 2:216640027-216640049 GACAGCATGGAGAAGGCAGGAGG - Intronic
946253727 2:218429095-218429117 GAAACCAGGGGGAAGGCAGCTGG - Intronic
946342511 2:219079982-219080004 GATTCCATGGAAAGGGCAGGAGG - Intronic
947351406 2:229249799-229249821 GATCCCCTGGGCAGGGCAGGCGG + Intronic
949037924 2:241826841-241826863 GATCCCATGGGGAAGGGAATAGG + Intergenic
1168771703 20:420366-420388 GGGTCCAAGGGGAATGCAGGTGG - Intronic
1169302670 20:4457776-4457798 CATTCCATGGGTACTGCAGGGGG + Intergenic
1169340924 20:4795663-4795685 CATTCCAAGGCTAAGGCAGGTGG + Intronic
1169451997 20:5719819-5719841 GAATCCAAAGGGAAGGCAGAGGG + Intergenic
1169501025 20:6160996-6161018 GCAGCCATGGGGTAGGCAGGTGG - Intergenic
1170015411 20:11775742-11775764 CATTACATGGCCAAGGCAGGAGG - Intergenic
1171350000 20:24494787-24494809 CAGTACATGGGGAAGGCTGGAGG - Intronic
1171395777 20:24832248-24832270 GCTGCCATGGGGAAGGTGGGAGG - Intergenic
1171443712 20:25187796-25187818 TATCCCATGCTGAAGGCAGGAGG + Intergenic
1171721066 20:28563872-28563894 AATTCAATGGGGAGGGAAGGTGG + Intergenic
1171756991 20:29119681-29119703 AATTCAATGGGGAGGGAAGGTGG - Intergenic
1171785264 20:29458205-29458227 AATTCAATGGGGAGGGAAGGTGG + Intergenic
1171863052 20:30418946-30418968 AATTCAATGGGGAGGGAAGGTGG - Intergenic
1172276500 20:33682559-33682581 GATCCCAGGGAGAAGGCAAGGGG - Intronic
1173817413 20:45998604-45998626 GATTACGTGGGGAAGGGAGAAGG + Intergenic
1175346834 20:58285524-58285546 GACTACATGGGGAAGGAAGTAGG + Intergenic
1175967736 20:62667966-62667988 GATTACAAGGGGAAGGCACGGGG - Intronic
1179181083 21:39045758-39045780 GGTCTCAGGGGGAAGGCAGGCGG + Intergenic
1181511502 22:23391199-23391221 GCTTCCAGGGAGAAGGCCGGCGG + Intergenic
1181968460 22:26672671-26672693 TATCCCACGAGGAAGGCAGGAGG + Intergenic
1182080244 22:27523728-27523750 GATTCCATCTGGTGGGCAGGGGG + Intergenic
1182457326 22:30460275-30460297 GTTCCCATGGGGAAGGGAAGAGG - Intronic
1182771237 22:32797825-32797847 GATTCCATGGGGAATCCTGTAGG - Intronic
1183004781 22:34892073-34892095 GGCTCCATGGGGAAGCCAGCAGG - Intergenic
1183142387 22:35955055-35955077 GATTACATTGTGAAGGGAGGTGG - Intronic
1184606676 22:45578445-45578467 GATTCCAAGGGGAAGGCGCATGG + Intronic
1184885867 22:47344110-47344132 GAGGGCATGGGGAAAGCAGGGGG + Intergenic
949981765 3:9506429-9506451 GATCTCATGGGGAAGGGAGAGGG - Intronic
950645439 3:14374108-14374130 GATTCCATGGGACATGGAGGGGG - Intergenic
951474946 3:23094907-23094929 GAATACATGGAGAAGGAAGGAGG + Intergenic
952344929 3:32474265-32474287 GATTCCAAGGGGAAAGCAATGGG + Intronic
953815836 3:46155380-46155402 GAGTCCATGGGGAAACCAGAAGG + Intergenic
954559309 3:51542851-51542873 GTTTGTATGGGGAAGCCAGGAGG + Intronic
954583508 3:51716270-51716292 GATCCCAAGGGGAAGGTGGGAGG + Intronic
954816631 3:53287161-53287183 GTTTCTATGGGGTAGGCTGGGGG + Exonic
954875142 3:53798201-53798223 GTTTCCATGAGAATGGCAGGTGG + Intronic
955723762 3:61910742-61910764 GGTTCTGTGGGGAAAGCAGGTGG - Intronic
956464515 3:69505851-69505873 GATCCTGTGGGGAAGGCAGCTGG + Intronic
959577873 3:107953995-107954017 TGTTCCATGGGACAGGCAGGGGG + Intergenic
966828062 3:183982130-183982152 GCTTCCAAAGGGGAGGCAGGAGG + Intronic
968019154 3:195368502-195368524 GATTCAAATGGGAATGCAGGAGG - Intronic
969376332 4:6765854-6765876 CATTCCAGGTGGAATGCAGGAGG - Intergenic
969430026 4:7148619-7148641 GCTTCCATGGGGAATGGAGGTGG + Intergenic
970006769 4:11418650-11418672 GTTCCCATGGTGCAGGCAGGTGG + Intronic
970032014 4:11686539-11686561 AAGTCCATAGGGATGGCAGGTGG + Intergenic
970163915 4:13216080-13216102 CATTCCATAGGGTAGGCATGAGG + Intergenic
970640879 4:18064658-18064680 CATACCATGGGGAAGGAAGGAGG - Intergenic
971150452 4:24025837-24025859 AATTCAATGGGGAAAGGAGGAGG + Intergenic
971298896 4:25425697-25425719 GCAGCCATGGGCAAGGCAGGAGG - Intergenic
971363615 4:25958880-25958902 GTTTCTGTGGGAAAGGCAGGAGG + Intergenic
976526625 4:86099468-86099490 TGTTCCATGGGGAAGGAAGGCGG + Intronic
976894449 4:90091665-90091687 GATCACATGGTGAAAGCAGGGGG + Intergenic
977809999 4:101347219-101347241 GATCACATGGGGAAGGCCGGGGG + Exonic
978256505 4:106698706-106698728 GATGCCAGGAGGAGGGCAGGAGG - Intergenic
978837094 4:113163983-113164005 GATGCCATGGGGAGGACAAGGGG - Intronic
982505124 4:156207010-156207032 GAGTACATGGGGAAGGCACAGGG + Intergenic
983058047 4:163122775-163122797 CATCACATGGTGAAGGCAGGAGG - Intronic
984129730 4:175859050-175859072 GATTGCCTGGGGATGGAAGGAGG + Intronic
985054728 4:186026287-186026309 GTTACCATGGGGAAGGGAGCTGG + Intergenic
985522052 5:378544-378566 GCTTCCCTGGGGAAGGCCGGAGG - Intronic
985983340 5:3489970-3489992 AATCCCATGGGGAGGGCAGAGGG + Intergenic
987050337 5:14143327-14143349 ATTTCAATGGGGAAGGAAGGAGG - Intergenic
987715450 5:21563432-21563454 AATTCCATAGGGAAGACAGCTGG - Intergenic
988705812 5:33725017-33725039 CATGAAATGGGGAAGGCAGGGGG - Intronic
988808578 5:34763330-34763352 GATTTCACAGGGAAGGTAGGAGG - Intronic
989200094 5:38754597-38754619 GGTTCCATGGAGCATGCAGGAGG - Intergenic
990140194 5:52694392-52694414 GATTCCATTGGGAGGTTAGGTGG + Intergenic
993352529 5:86867867-86867889 GTTTTCATGGGGAAAGCAGAAGG - Intergenic
993832848 5:92780719-92780741 GGTTCCATGAAGAAGACAGGGGG - Intergenic
997985990 5:138501990-138502012 GATTCCTGGGAGAAGGCATGAGG - Intergenic
998038824 5:138937945-138937967 GCTTCCGTGGGGAGGGGAGGAGG - Intergenic
998458825 5:142294440-142294462 GATTCCCTCGGGGAGGCAGGGGG + Intergenic
1000036871 5:157455425-157455447 TATTCCATGGGATAGGCAAGGGG + Intronic
1001398981 5:171435627-171435649 GGGTCCATGGGGAAAGAAGGAGG - Intronic
1001601564 5:172932331-172932353 AATTCCCTGGGCACGGCAGGGGG - Intronic
1001716960 5:173824255-173824277 GCTTCCAAGAGGAAGGCTGGGGG - Intergenic
1002277724 5:178114306-178114328 GATCTCATGGGGAAGTCAGAGGG - Intronic
1002375405 5:178785304-178785326 GCTTCCTTGGGGAAGGGGGGCGG + Intergenic
1002465062 5:179404117-179404139 GCTCCCATGGGGAAGACTGGAGG + Intergenic
1002813471 6:656945-656967 GATGCCACAGGGAAGGCAGCTGG + Exonic
1003049688 6:2767863-2767885 GATTCCAAAAGGCAGGCAGGCGG + Intronic
1003435783 6:6086658-6086680 GGCTCCATGGGGAAGTCAAGAGG + Intergenic
1004134571 6:12954291-12954313 GATTCCATTTGAAAGGCAGTAGG + Intronic
1004166157 6:13258244-13258266 GCTTCTAGGGGGGAGGCAGGAGG + Intronic
1006106589 6:31720526-31720548 GATACCATGGGGAAAGAATGTGG + Intronic
1006426746 6:33968124-33968146 GCTGCAATGGGGAATGCAGGAGG - Intergenic
1006819466 6:36880269-36880291 GAATCCATGGGAAAAACAGGAGG + Intronic
1007093290 6:39197872-39197894 GATTCCATGGGGATGACCAGAGG - Intronic
1007377292 6:41465637-41465659 GGTTCCAAGGGGCAGGGAGGGGG - Intergenic
1009001274 6:57718612-57718634 AATTCCATAGGGAAGACAGCTGG + Intergenic
1010137929 6:72577059-72577081 GTTTCCAGGGGTTAGGCAGGAGG + Intergenic
1010190270 6:73188145-73188167 GATGCCATGGGAAAACCAGGAGG + Intronic
1010866345 6:80980519-80980541 CATTACATAAGGAAGGCAGGGGG - Intergenic
1011035282 6:82967457-82967479 GAGGCGATGGGGAAGGGAGGTGG - Intronic
1013230290 6:108156604-108156626 GTTTCTTTGGGGAAGGAAGGAGG - Intronic
1014429714 6:121353791-121353813 GATTCTATGGGGCAGGGTGGCGG - Intergenic
1014605376 6:123467290-123467312 GATTCCAGGTGGAAGGTATGTGG + Intronic
1016131694 6:140481131-140481153 GCTTCCATGGGCAATGCAGATGG + Intergenic
1017414761 6:154207962-154207984 GATTCCATCGGGATAGCAGTGGG - Intronic
1017442175 6:154474620-154474642 GATGCCCTTGGGAAGGCAGCTGG + Intronic
1017497499 6:154995037-154995059 AATTCCTTGGGGAAGGGACGGGG + Intronic
1017710607 6:157164010-157164032 GATTCCTGGAGGAAGGTAGGTGG - Intronic
1017957288 6:159189172-159189194 TATACCATGGGATAGGCAGGGGG + Intronic
1018245734 6:161821990-161822012 GATGCCAGGGGCCAGGCAGGTGG - Intronic
1018705773 6:166462239-166462261 GGTTCCATGGGGAGGGGAAGGGG - Intronic
1019029885 6:169000872-169000894 GACCCCATGGGGAAAACAGGAGG + Intergenic
1019475642 7:1242808-1242830 GATTCCGCGGGGAGGGCAGCTGG + Intergenic
1019750628 7:2726900-2726922 GTGCCCATGGGGATGGCAGGTGG - Intronic
1023159669 7:37284962-37284984 TATTCCATGGGGAAGGCCTCAGG + Intronic
1023227956 7:37991561-37991583 GATTCCATGTGGATGGGAGAGGG + Intronic
1023533260 7:41181563-41181585 GATTCCATGGGAAAGCCGGAGGG + Intergenic
1023653936 7:42401041-42401063 GATTCCAGGAGAAAGCCAGGGGG + Intergenic
1023766126 7:43512320-43512342 GATTCCAGAGTGAAGGGAGGTGG - Intronic
1024123215 7:46266376-46266398 ACTTCCATGGGGACGGCAGTAGG - Intergenic
1024705193 7:51949922-51949944 CATTCCATGGCAGAGGCAGGAGG + Intergenic
1026760921 7:73125121-73125143 GATAGCATGGGGTAGGCTGGTGG - Intergenic
1027037263 7:74933917-74933939 GATAGCATGGGGTAGGCTGGTGG - Intergenic
1027086299 7:75267535-75267557 GATAGCATGGGGTAGGCTGGTGG + Intergenic
1028282734 7:88952078-88952100 GATTCCATGGGGGAGAAATGTGG + Intronic
1028532327 7:91851694-91851716 GGTTCCCTGGGGAGGGCAGTGGG - Intronic
1029392601 7:100285562-100285584 GATAGCATGGGGCAGGCTGGTGG + Intergenic
1030607624 7:111654695-111654717 GATTGGATGGTGAAGGGAGGTGG + Intergenic
1033539773 7:142345681-142345703 GTTTCCATGGGGACTGCGGGGGG - Intergenic
1035000931 7:155611547-155611569 AAGTCCATGGGGCAAGCAGGTGG - Intronic
1035070452 7:156140902-156140924 GCTTCCACTGGCAAGGCAGGCGG + Intergenic
1035102599 7:156413974-156413996 GAATCCATGGTGGAGGCATGAGG + Intergenic
1035102604 7:156414011-156414033 GAATCCATGGTGGAGGCATGAGG + Intergenic
1035166467 7:156993332-156993354 GATTCCACGGCCAAAGCAGGGGG + Intergenic
1035608602 8:946156-946178 GACTCCCTGGGGGAGTCAGGGGG - Intergenic
1035610245 8:957263-957285 GGTGCCATGGGGAAGACAGGAGG - Intergenic
1035787647 8:2274907-2274929 GACTCCAAGGGGAAGGAGGGAGG - Intergenic
1035805163 8:2446809-2446831 GACTCCAAGGGGAAGGAGGGAGG + Intergenic
1036417085 8:8560861-8560883 GATTGCCAGGGGAAGGGAGGAGG + Intergenic
1036443602 8:8802871-8802893 GAATTCATGGGGAAGGCAGGTGG + Intronic
1037168690 8:15863030-15863052 TATTCCATGGGGTAGGGTGGAGG + Intergenic
1037290039 8:17340788-17340810 AATTCCATGGAGAAGGGAGTAGG - Intronic
1037575528 8:20198338-20198360 GGTTCTTTGGGGAAGCCAGGTGG + Intronic
1037717158 8:21410265-21410287 CATTCAATTGGGAAGGCAGGAGG + Intergenic
1038024440 8:23576197-23576219 GATTCCATGGTGGAGGGAGAGGG - Intergenic
1038041960 8:23730715-23730737 GATTCAAGGGGGAAGGACGGAGG - Intergenic
1038248186 8:25878523-25878545 AATTCAATGGGAAAGACAGGAGG + Intronic
1038271885 8:26081975-26081997 GATTCCATGGAGAGGGGAAGAGG - Intergenic
1038421534 8:27437041-27437063 GAGGCCATGGGGAGGCCAGGAGG + Intronic
1039074519 8:33677755-33677777 GGTTCCATGCTGAAAGCAGGAGG - Intergenic
1040530196 8:48260633-48260655 AATGCCCTGGGGAAGGAAGGTGG - Intergenic
1042511592 8:69617982-69618004 GATTCCATGGGGAAGGCAGGAGG - Intronic
1045569057 8:103351193-103351215 GATTATATGGGGAAAGCAGTTGG - Intergenic
1047131902 8:122030479-122030501 GGTTCCATATGGGAGGCAGGTGG + Intergenic
1048139521 8:131779905-131779927 GACTCAAAAGGGAAGGCAGGTGG - Intergenic
1048846002 8:138604214-138604236 GATTCCACGGAGAGTGCAGGGGG + Intronic
1049292340 8:141811055-141811077 GATCCCATAGGGAGGGCAGAGGG + Intergenic
1050844382 9:10195733-10195755 GAAGCCATGGGGAAGGGTGGAGG + Intronic
1051141404 9:13983211-13983233 GGTTCCTTGGGGAGGGAAGGGGG + Intergenic
1051571870 9:18567534-18567556 GATTTCATGGGGATAGCAGGAGG + Intronic
1051942386 9:22523701-22523723 GATTCTATGGGGAAGCCTGATGG + Intergenic
1052278830 9:26709258-26709280 GTTGCCAGGGAGAAGGCAGGAGG + Intergenic
1057027910 9:91749365-91749387 GGTGCCATCTGGAAGGCAGGAGG - Intronic
1057091415 9:92261432-92261454 GATGACAGTGGGAAGGCAGGAGG + Intronic
1057276633 9:93679659-93679681 CTTTCCATGAGGAACGCAGGTGG - Intergenic
1058866111 9:109163869-109163891 GATTCAGTGGAGAAGGAAGGAGG - Intronic
1059726972 9:117018329-117018351 GATTTCTTGGGAAAGGCAGAAGG - Intronic
1060596554 9:124852363-124852385 GAATCCATGGGCGGGGCAGGTGG + Intergenic
1060815700 9:126634037-126634059 GAATGTTTGGGGAAGGCAGGAGG + Intronic
1060948064 9:127581967-127581989 GATTGCATGGGGAGGGAGGGAGG - Intergenic
1061232008 9:129320686-129320708 GCTGCCATGGGGAAGGGAGGAGG - Intergenic
1061478424 9:130884446-130884468 GGCCCCATGGGGAACGCAGGAGG - Exonic
1061907069 9:133704237-133704259 GTTGCCATGGGGATGGAAGGTGG + Intronic
1062183385 9:135203097-135203119 GATGCCCTGGGGGAGGCATGTGG - Intergenic
1062221746 9:135419760-135419782 CATTCTGTGAGGAAGGCAGGTGG + Intergenic
1202801500 9_KI270720v1_random:3662-3684 AATTCAATGGGGAGGGAAGGTGG + Intergenic
1186842335 X:13496159-13496181 GATGCCATGGGGGAGGGAGGTGG + Intergenic
1187579602 X:20593745-20593767 TGTTCCATGGGGCAGGCCGGGGG + Intergenic
1188290337 X:28379839-28379861 TATCCCATGGGCGAGGCAGGGGG + Intergenic
1189105659 X:38232772-38232794 AAGTCCATGGGGCAGGCAGTAGG - Intronic
1190289634 X:48983702-48983724 CAGTCCATGGGGATGGGAGGAGG - Intronic
1190879732 X:54483742-54483764 CCTGCGATGGGGAAGGCAGGAGG - Intronic
1192164832 X:68821515-68821537 GCTTCCATGGGGAGGGGAGAAGG + Intergenic
1193915008 X:87353360-87353382 GTTTCCTTGGGGAAGGATGGGGG + Intergenic
1194131473 X:90087734-90087756 GACTCCATGGGAAAAACAGGAGG - Intergenic
1194614699 X:96086734-96086756 GTTTCCATGGGGAAGGCTTATGG + Intergenic
1194853118 X:98893067-98893089 GATACACTTGGGAAGGCAGGTGG + Intergenic
1196126087 X:112100732-112100754 CATTCCATGTGGGAGGAAGGAGG + Intergenic
1196603283 X:117626259-117626281 TTTTCCATGGGGAAGGTAGTAGG - Intergenic
1196893463 X:120311239-120311261 GATTCCATGGGTAAGTCTAGCGG - Exonic
1199204690 X:145135144-145135166 GCTTCTATGGGGTAGGAAGGAGG + Intergenic
1200064422 X:153497696-153497718 GGTTCCCTGGGGAAGGCCTGGGG + Intronic
1200126074 X:153815725-153815747 GGTTCCCTGGGGAAGGCCTGGGG - Intronic
1200912875 Y:8546562-8546584 GATACCATAGAGAAGACAGGTGG - Intergenic