ID: 1042514374

View in Genome Browser
Species Human (GRCh38)
Location 8:69644253-69644275
Sequence GATTTGAACTCAAACTAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042514374_1042514377 -6 Left 1042514374 8:69644253-69644275 CCTGATTAGTTTGAGTTCAAATC 0: 1
1: 0
2: 1
3: 22
4: 167
Right 1042514377 8:69644270-69644292 CAAATCCCAGCCTCGCTGGTGGG No data
1042514374_1042514376 -7 Left 1042514374 8:69644253-69644275 CCTGATTAGTTTGAGTTCAAATC 0: 1
1: 0
2: 1
3: 22
4: 167
Right 1042514376 8:69644269-69644291 TCAAATCCCAGCCTCGCTGGTGG No data
1042514374_1042514381 19 Left 1042514374 8:69644253-69644275 CCTGATTAGTTTGAGTTCAAATC 0: 1
1: 0
2: 1
3: 22
4: 167
Right 1042514381 8:69644295-69644317 TGCTTAGAACAGACCCTAGCAGG No data
1042514374_1042514375 -10 Left 1042514374 8:69644253-69644275 CCTGATTAGTTTGAGTTCAAATC 0: 1
1: 0
2: 1
3: 22
4: 167
Right 1042514375 8:69644266-69644288 AGTTCAAATCCCAGCCTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042514374 Original CRISPR GATTTGAACTCAAACTAATC AGG (reversed) Intronic
901667253 1:10833251-10833273 GATTTGAACTCAGAGCCATCAGG - Intergenic
903247158 1:22024593-22024615 GCTTTGAAGTCATACTGATCTGG - Intergenic
905451054 1:38056641-38056663 GAGTTGAACTCAAACTTGCCAGG + Intergenic
907668867 1:56457085-56457107 GCTTTGAACTCAAACAGATTTGG + Intergenic
907822330 1:57983023-57983045 GAATTGGACTCAAACAGATCTGG - Intronic
909159254 1:72124582-72124604 TATTTGAACTAAAATTAATCTGG + Intronic
909250760 1:73352908-73352930 GATTTGAAATCAATCTAGACTGG + Intergenic
911063566 1:93768386-93768408 ACTTTGAACTCAAACCCATCAGG - Intronic
912328496 1:108793672-108793694 AATATAAACTAAAACTAATCAGG - Intronic
913083633 1:115413594-115413616 GATTTGAACTCAACTCTATCTGG - Intergenic
913547582 1:119884757-119884779 GATTTGCAGTCAGACTGATCTGG + Intergenic
914729238 1:150356001-150356023 GGTCTGTACTCAAACAAATCTGG - Intergenic
915432878 1:155880214-155880236 GATTTGAATCCAGGCTAATCTGG + Intronic
916522338 1:165575405-165575427 GCTTTGAAGTCAAACAAATCTGG + Intergenic
922887862 1:229033887-229033909 GATTTGAACACAAATTGCTCAGG - Intergenic
1063226245 10:4017514-4017536 GAGTTGATCTGAAAATAATCAGG - Intergenic
1064861628 10:19832873-19832895 GATTTGGACTCAAGCCCATCTGG - Intronic
1070006003 10:72424716-72424738 GATTTGAACTCAGCCTTATTTGG + Intronic
1074310485 10:112318279-112318301 GATTTGAAAACAAATTAATTAGG - Intergenic
1074587754 10:114784815-114784837 GTTTTGGAATCAAACAAATCTGG - Intergenic
1076040287 10:127241750-127241772 GGTTTGACATCAAACTAAACAGG + Intronic
1077987147 11:7364564-7364586 GTTTTAAAGTCAAACAAATCTGG - Intronic
1078271845 11:9803052-9803074 GATTTGAAGTCATACTGATAGGG + Intronic
1078736446 11:14024919-14024941 GATTAGAACTGAAAAGAATCTGG + Intronic
1079769270 11:24438204-24438226 GATATAAACTCACACTAATTTGG + Intergenic
1079787839 11:24697987-24698009 GATTTAATCTCCAACCAATCAGG + Intronic
1080845111 11:36020176-36020198 GGTTTACACTCAAGCTAATCTGG + Intronic
1080942287 11:36932783-36932805 GGTTTGAATTCAAACCAACCTGG + Intergenic
1081588756 11:44406312-44406334 GATTTGAACTCACAGTTGTCAGG - Intergenic
1085287354 11:75372242-75372264 GATTTGAACCCAGACTGGTCTGG + Intergenic
1086155750 11:83663942-83663964 CATTTGGAATCAAACTGATCTGG + Intronic
1088105856 11:106205963-106205985 GTTTTGCATTCACACTAATCTGG + Intergenic
1088891230 11:114046176-114046198 GCTTTGAAATCATACTAATGTGG - Intergenic
1089396531 11:118139647-118139669 GATTTGAACTGTGACTAATTTGG - Intronic
1093212545 12:16325200-16325222 GATTTTTACTCAAATAAATCAGG + Intergenic
1093337690 12:17927540-17927562 AATTTGAACTCAAAATTGTCAGG + Intergenic
1093374387 12:18406968-18406990 GCTTTGAAATCAGACTTATCTGG + Intronic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1094638502 12:32249942-32249964 TATTTGAGCTCAAAATGATCTGG - Intronic
1095832861 12:46605744-46605766 GTTTTAAAGTCAAACAAATCTGG - Intergenic
1099855754 12:88163895-88163917 GATTTGAACTCATCAAAATCAGG + Intronic
1101748474 12:107562673-107562695 GAGTTGAACTAAAACAAATTGGG + Intronic
1101794384 12:107959305-107959327 GATCTGAATTCAGACAAATCTGG + Intergenic
1102216898 12:111168070-111168092 GATTTGAACTCAAGCCAGTCCGG + Intronic
1102409760 12:112707503-112707525 GCTTTGAAGTCAGACTGATCTGG - Intronic
1105576005 13:21652549-21652571 CATTTGAACTCCACATAATCAGG + Intergenic
1106089975 13:26582284-26582306 GATTTGAACACAAATCAGTCTGG - Intronic
1106926040 13:34614184-34614206 GATTTGAACTCTTCCTAAACTGG - Intergenic
1109673183 13:65637278-65637300 GGTTTGATAACAAACTAATCAGG - Intergenic
1110964977 13:81682948-81682970 GAATTTAATTAAAACTAATCAGG - Intergenic
1111866647 13:93777031-93777053 GATTTGAACTCAACCAGATGTGG - Intronic
1113399218 13:109975938-109975960 GATTTTAACTCAATCTATTCAGG + Intergenic
1113724295 13:112587282-112587304 GATTTGATATAAAACTATTCTGG - Intronic
1114915437 14:27258520-27258542 GATTTGAAATTAAACACATCTGG + Intergenic
1115665769 14:35544151-35544173 GCTTTGGAATCAAACTAATCTGG - Intronic
1120665018 14:87295328-87295350 GTTTTGTACTCAATCTACTCAGG - Intergenic
1125167395 15:36723895-36723917 GAATTTAATTCAAACTAATAGGG + Intronic
1125993847 15:44136972-44136994 CAATTGAACTCTAACTAATATGG - Intronic
1130015792 15:80185466-80185488 GATTTGAACCCAAACCCATGTGG + Intronic
1130834256 15:87633670-87633692 GATTTGAGCCCAAACAATTCTGG - Intergenic
1134056331 16:11172435-11172457 TATGTGAACTCCAACTAATCTGG - Intronic
1135269581 16:21057548-21057570 GATTTGAACTCAAGTCCATCAGG + Intronic
1135673562 16:24395109-24395131 GCTTTGAAATCAAACAGATCTGG - Intergenic
1135903364 16:26487360-26487382 GCTTTAACATCAAACTAATCTGG - Intergenic
1137802486 16:51274126-51274148 GCTTTGAACTCACACTAAACTGG - Intergenic
1137888866 16:52137107-52137129 CATTTGAACTGATATTAATCTGG - Intergenic
1139206101 16:65030429-65030451 GATTTGAACTAAAAATAACATGG - Intronic
1139410604 16:66756617-66756639 GATTTGAACCCATAATAATCAGG + Intronic
1141346689 16:83253081-83253103 GATTGTAACTCTTACTAATCTGG + Intronic
1143317985 17:6047286-6047308 GATTTGAACCCAAGTTGATCAGG + Intronic
1144484562 17:15653954-15653976 CATTTGAACTCAAATGAATTTGG + Intronic
1150188341 17:63210743-63210765 GATTTGCTCTTAAAATAATCAGG + Intronic
1150384284 17:64745681-64745703 GATTTGAATTCAGACAGATCTGG + Intergenic
1150771802 17:68048557-68048579 GATTTGAATTCAGACAGATCTGG - Intergenic
1203162848 17_GL000205v2_random:67570-67592 AATTTGAACTCAATTGAATCTGG + Intergenic
1153362659 18:4214774-4214796 CATTTGAACTTAGTCTAATCAGG + Intronic
1153364509 18:4239706-4239728 GATTTAAAATCAAACTATACAGG + Intronic
1153706767 18:7753749-7753771 GATATGAACTAACACTAAACTGG - Intronic
1157595274 18:48860349-48860371 GGTTTGATCTCCCACTAATCCGG - Exonic
1159141904 18:64407077-64407099 TATTTGAACACAAAACAATCTGG - Intergenic
1165442406 19:35837164-35837186 GATTTGAACCCAAGCTTCTCTGG + Intronic
1166366310 19:42280252-42280274 GATTTGAACCCAAATCTATCTGG - Intronic
1166566053 19:43766334-43766356 GCTTTGAACTCAGACAGATCAGG - Intergenic
1167168858 19:47817802-47817824 GATTTAAACCCAAACTCATGTGG + Intronic
925614200 2:5729778-5729800 GATTTAAAATCAGACAAATCTGG + Intergenic
930406521 2:50963937-50963959 TATTTGAGCTCAAATTAAACTGG - Intronic
930561430 2:52964166-52964188 GCTTTGGAATCAAACCAATCTGG - Intergenic
931313763 2:61106732-61106754 AATTTCAACTTAAACTGATCAGG - Intronic
933430512 2:82171377-82171399 GATTTGGAATCAAACAAATCAGG + Intergenic
933841883 2:86293629-86293651 GATTTGAATTCAAATTATACAGG + Intronic
936256864 2:110923548-110923570 GATTTGAACTCAGGATAGTCTGG - Intronic
936644467 2:114352564-114352586 GATTTGAACCCAATTCAATCTGG - Intergenic
937612117 2:123874735-123874757 TATTTGAAATGAGACTAATCTGG - Intergenic
939525754 2:143291735-143291757 GATTTGAATTCAAACTGATGAGG + Intronic
940480204 2:154219372-154219394 GATTTGAATTCAGGCAAATCTGG + Intronic
941699199 2:168585868-168585890 CATTTGAACTTAAAGAAATCAGG - Intronic
942256371 2:174103559-174103581 GATTTGAAGTCAATCTATTCTGG - Intronic
942384037 2:175422592-175422614 GATTTGAAATAAAAATGATCTGG + Intergenic
942932745 2:181515180-181515202 GATTTGAAGTCAATCTGACCTGG + Intronic
943401546 2:187418048-187418070 CATTTAACCTCAAACTAAGCTGG - Intronic
944088024 2:195871662-195871684 TATTTGAAGTCAAACTAACAAGG + Intronic
944128217 2:196318232-196318254 AATTTGAACTCAAGCCCATCTGG + Intronic
944211985 2:197216011-197216033 AATTTAAAGTCAAACCAATCGGG + Intronic
944444868 2:199779383-199779405 GATCAGCACACAAACTAATCAGG + Intronic
945604947 2:211917543-211917565 GATTTGAACCCAAAGAAGTCTGG + Intronic
947075354 2:226337925-226337947 GATTCAAACTCTATCTAATCAGG - Intergenic
947802477 2:232938882-232938904 AATTAGAACTCAAACTAGGCCGG + Intronic
948545020 2:238721742-238721764 GATTTGAACCCAAATTTATCTGG - Intergenic
1173900826 20:46587825-46587847 GATTTGGAGTCAGACTAAACTGG - Intronic
1181869796 22:25888720-25888742 GATTTGAACTCAGACCAGTCAGG - Intronic
1182529693 22:30945702-30945724 GATTTAAACTCAGAATATTCTGG + Intronic
950852776 3:16078730-16078752 GACTGGAATTCAAAGTAATCAGG - Intergenic
951328105 3:21330107-21330129 CATTTGAGCTCAAATTAGTCTGG + Intergenic
951768038 3:26222253-26222275 CGTTTGACCTCAAACTAATTTGG + Intergenic
952571082 3:34717215-34717237 ATTTTGGACTCAAACAAATCTGG - Intergenic
955819950 3:62886127-62886149 GATTTGAACCCAAACCTATCTGG - Intergenic
956554357 3:70501654-70501676 GATTGGAACTCAAATCCATCTGG + Intergenic
959813006 3:110641499-110641521 TTGATGAACTCAAACTAATCTGG - Intergenic
960260429 3:115561764-115561786 GATTTGAACTCACATTCATCTGG - Intergenic
960702791 3:120453106-120453128 GGTTTGAGGTCAAACCAATCTGG + Intergenic
962049996 3:131803118-131803140 GATTTGAATTCAAACATTTCTGG - Intronic
962865276 3:139443370-139443392 GATTTGAAATCATTCTAATCCGG + Intergenic
963039996 3:141063178-141063200 AGTGTGAACTCAAACTAAGCAGG - Intronic
963835120 3:150050383-150050405 GATTTGCACCCAAACTATTCTGG - Intronic
964006360 3:151834142-151834164 CATTTGAAATAAAACCAATCTGG + Intergenic
964929642 3:162001642-162001664 GATTTTAACACAAAGTTATCAGG - Intergenic
965409881 3:168317642-168317664 GATTTGAACACATGCAAATCAGG + Intergenic
965508974 3:169547492-169547514 GCTTTGGAGGCAAACTAATCTGG + Intronic
967637562 3:191821504-191821526 GATTGGAACTCAAATTAAAATGG - Intergenic
970162689 4:13205157-13205179 GATTTGAACTCAGACCCATTGGG - Intergenic
970717138 4:18939643-18939665 GAGTTCATCTTAAACTAATCAGG - Intergenic
973135972 4:46707432-46707454 GTTTTGAAATCAAACAAATGAGG + Intergenic
975775021 4:77777141-77777163 GATATGTACTCATACTAATTAGG - Intronic
977710513 4:100119084-100119106 GATTTGATCTCAATATTATCAGG - Intergenic
977768866 4:100832916-100832938 GATGTGAACTAAGACTAATAGGG - Intronic
977866515 4:102034821-102034843 GATTTGGACCCAGATTAATCTGG + Intronic
979504186 4:121476638-121476660 GATTTCAACTCAAATTAATACGG + Intergenic
981932029 4:150200642-150200664 AATTGGAACTCAAACTGAGCTGG + Intronic
982610001 4:157560802-157560824 GCTTTAAACTCAAATTAATGTGG - Intergenic
982875635 4:160646136-160646158 GATCTCAACTCAAACTAACAAGG - Intergenic
989217042 5:38916358-38916380 GATTTGAACTCAAGGTAGTTAGG - Intronic
992387491 5:76299527-76299549 GCTTTGAAATCAAATAAATCTGG - Intronic
999043987 5:148447982-148448004 GGTTTGAAGTCAAACAATTCAGG - Intergenic
999296668 5:150463846-150463868 GATTTGAACTCAAGTTTGTCTGG - Intergenic
999342558 5:150784766-150784788 GATTTAAACCCAAACTAACAAGG - Intronic
1000139875 5:158392140-158392162 CAAAAGAACTCAAACTAATCTGG - Intergenic
1007027388 6:38590417-38590439 GATTTGAAGTCAAATTTGTCTGG + Intronic
1008859036 6:56127033-56127055 GATTTGAACTCAAAGAGATGTGG - Intronic
1010465168 6:76159297-76159319 GATTTGAATTCTAACTTATAAGG - Intergenic
1011346623 6:86376639-86376661 GATTTCAACCCTAAATAATCAGG - Intergenic
1012712347 6:102623466-102623488 GAATTGAATTCCAACTAATCTGG - Intergenic
1012979708 6:105816596-105816618 GATTTGAACTCAGAATAATCTGG - Intergenic
1013863629 6:114666497-114666519 AATTTGAACTTAAATTAATATGG - Intergenic
1014522670 6:122464423-122464445 GATTTAAACTCAGACTTATCTGG + Intronic
1014695592 6:124617024-124617046 ATCTTGAACTCAAACTAACCTGG - Intronic
1016897754 6:149070329-149070351 GATATGAACTCTAGCTAATCTGG - Intronic
1022144716 7:27525459-27525481 TATTTGAATTCAAAATAATATGG + Exonic
1023123896 7:36936092-36936114 GAGTTGCACTCAGACCAATCAGG - Intronic
1023759427 7:43450186-43450208 GATTTCTCCTCAAAATAATCTGG + Intronic
1025902131 7:65753116-65753138 GATTTGAGTTCAGAATAATCAGG + Intergenic
1026109184 7:67445354-67445376 CTTTTGAACTCAATCTATTCTGG - Intergenic
1028818043 7:95171216-95171238 GCTTTAAACCCAAACTTATCAGG + Intronic
1029197360 7:98814891-98814913 GAGTTGGACTCAAACTTGTCTGG - Intergenic
1029841490 7:103368644-103368666 CATTTGATTTCAAATTAATCAGG + Exonic
1031781264 7:125968831-125968853 AATTTGAATTCAAACTATTTTGG + Intergenic
1037070004 8:14632764-14632786 GATTTAAAGTCAAAGTAAACGGG + Intronic
1041618494 8:59935983-59936005 GCTTTGAAATCAATCAAATCAGG - Intergenic
1042514374 8:69644253-69644275 GATTTGAACTCAAACTAATCAGG - Intronic
1043316689 8:78931632-78931654 GAATTGAACTCCAATTATTCTGG - Intergenic
1045799505 8:106086209-106086231 TTTTTGAACTCAAAGTAATTAGG - Intergenic
1048071207 8:131022996-131023018 GATTTGAACTGAAGTTAATTTGG - Intronic
1048884737 8:138900895-138900917 GATTTGAACACAAAAAAAGCAGG + Intronic
1050402786 9:5273930-5273952 ATTTTGAACTCAAACACATCAGG - Intergenic
1052399438 9:27981911-27981933 GATTAAACCTCAAACTAACCTGG - Intronic
1058311763 9:103513225-103513247 GATATTAACTCAAACTTATAAGG + Intergenic
1058344076 9:103938528-103938550 AATTTGAAAACAAGCTAATCTGG + Intergenic
1059384376 9:113952588-113952610 GACTTGAACCCAAGCTTATCTGG - Intronic
1187000374 X:15170737-15170759 AACTTGAACTCAAACTTATTGGG + Intergenic
1187481285 X:19658184-19658206 GATTCGACCACAAAATAATCAGG + Intronic
1187564472 X:20434907-20434929 GATTTGAACCCAAAGAAATCTGG - Intergenic
1189614929 X:42773465-42773487 GATTTGAAGTCAAAAAGATCTGG - Intergenic
1190218399 X:48495280-48495302 GAGCTGAACTCAAGCTACTCTGG + Intergenic
1193800671 X:85932029-85932051 GAATTAAACTCAATTTAATCTGG + Intronic
1194092586 X:89597591-89597613 TATTTGAACTAAAAATAATAAGG - Intergenic
1196981666 X:121221233-121221255 GATTTGGAGTCAAACCAACCTGG - Intergenic
1197085320 X:122467195-122467217 GATTTGAACTCCAATCTATCTGG - Intergenic
1198300358 X:135328373-135328395 GTTCTGAACCCAAACTAATTGGG + Intronic
1198675991 X:139131228-139131250 GATTTGAACCCAGATTTATCTGG - Intronic
1199096881 X:143753907-143753929 GATTTGGAGTCAAACTTTTCTGG - Intergenic
1199810287 X:151342345-151342367 GATTTGAACTCAGACAATTTAGG - Intergenic
1200445233 Y:3253698-3253720 TATTTGAACTAAAAATAATAAGG - Intergenic