ID: 1042517196

View in Genome Browser
Species Human (GRCh38)
Location 8:69671927-69671949
Sequence TGTAACTAAAATACTCAGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042517193_1042517196 -8 Left 1042517193 8:69671912-69671934 CCAGTGCTTTCAAGATGTAACTA 0: 1
1: 0
2: 0
3: 18
4: 153
Right 1042517196 8:69671927-69671949 TGTAACTAAAATACTCAGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 156
1042517192_1042517196 5 Left 1042517192 8:69671899-69671921 CCACACAGATTTGCCAGTGCTTT 0: 1
1: 0
2: 1
3: 23
4: 269
Right 1042517196 8:69671927-69671949 TGTAACTAAAATACTCAGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 156
1042517191_1042517196 21 Left 1042517191 8:69671883-69671905 CCAGAAAAAAAGAAAACCACACA 0: 1
1: 0
2: 17
3: 267
4: 1994
Right 1042517196 8:69671927-69671949 TGTAACTAAAATACTCAGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042517196 Original CRISPR TGTAACTAAAATACTCAGGT GGG Exonic
907534749 1:55140827-55140849 AGTAACTAAAATACTTTTGTGGG - Intronic
907877588 1:58508274-58508296 TGTAAATAAAATACTCATTTTGG - Intronic
908847846 1:68342985-68343007 GGGGACTTAAATACTCAGGTTGG + Intergenic
908967993 1:69788777-69788799 TGTAATGAAAATGCACAGGTAGG - Intronic
911956728 1:104245540-104245562 TTTAAATAAAATACGTAGGTGGG + Intergenic
913360689 1:117977011-117977033 TTTAAATAAAATATTCAGGCTGG + Intronic
913419266 1:118647055-118647077 GCTAACTAATATACTAAGGTTGG - Intergenic
914869815 1:151463656-151463678 TGTAACTGAAAAGCTCAGCTTGG - Intergenic
1062926827 10:1322397-1322419 TCTAACTCAAATACTCAGTTTGG - Intronic
1066428708 10:35332902-35332924 GGTAAATATAAAACTCAGGTGGG - Intronic
1072162172 10:92778489-92778511 TGTAACTTTCATTCTCAGGTTGG - Intergenic
1074173934 10:110976675-110976697 TGTCTCTAAAATACTGAGGGGGG - Intronic
1074611138 10:115023169-115023191 TCCAACTAAAATAATCAGCTTGG - Intergenic
1078466001 11:11550854-11550876 TGGAACTACAATATTCAGGATGG - Intronic
1082913654 11:58406664-58406686 TTTTTCTAAAATACTGAGGTGGG - Intergenic
1084071873 11:66742015-66742037 TGTCACTATAATGCCCAGGTTGG + Intergenic
1084570147 11:69954672-69954694 AGAATCTAAAATACACAGGTAGG - Intergenic
1085650669 11:78265917-78265939 TGTAACTAAAACATTCAGCCAGG + Intronic
1089064027 11:115648753-115648775 TGAATCCAAAATACCCAGGTTGG - Intergenic
1092102943 12:5901211-5901233 AGAAACACAAATACTCAGGTGGG + Intronic
1092390441 12:8072878-8072900 TGTATCTAGAATAGCCAGGTAGG + Intergenic
1094270294 12:28606971-28606993 TGAAAGTAAAACACTCAGCTGGG - Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1097404573 12:59174791-59174813 TGTAACAAAAATACTTAGAATGG + Intergenic
1097628638 12:62032486-62032508 TGTAACTATAATAATAATGTTGG + Intronic
1098112574 12:67138926-67138948 TGTTAGTAGAATACTCAGGAAGG + Intergenic
1099172077 12:79376768-79376790 TTTAACTTAAATTCACAGGTAGG + Intronic
1099333315 12:81319967-81319989 TGTATATAGAATACTCAGATGGG + Intronic
1099807558 12:87539376-87539398 TGGAATTAAAATACACAGCTTGG - Intergenic
1100137912 12:91577348-91577370 TGTAATAAAAATTCTCTGGTTGG - Intergenic
1101964285 12:109271745-109271767 TCTAACTAAAACACACAGCTAGG + Intergenic
1109750151 13:66681380-66681402 TGTAACTAAAATACTGAATTAGG - Intronic
1114895674 14:26988031-26988053 GGTAACTAAAATTCTGAAGTCGG + Intergenic
1116731052 14:48623119-48623141 TGTAGCTAACATACTCGGGTTGG - Intergenic
1116826767 14:49680496-49680518 TGTAAATAAAGTACTGAGGATGG - Intronic
1117915999 14:60678664-60678686 TGAAACTAAAATACTTGGTTGGG + Intergenic
1118884871 14:69858242-69858264 TATAGCTAAAATACACAGCTGGG - Intronic
1120531743 14:85640262-85640284 TGGAAATAAAGTATTCAGGTTGG - Exonic
1120598409 14:86470268-86470290 TGCAACTAAAATAGTAATGTGGG + Intergenic
1121826377 14:97013093-97013115 TCTGGCTAAAATGCTCAGGTTGG + Intergenic
1125165599 15:36701068-36701090 TCTAACTAAAATAGGTAGGTAGG + Intronic
1126531926 15:49719978-49720000 TCAAACTAAAATACTATGGTGGG + Intergenic
1126834761 15:52649422-52649444 TGTAACTTAAAAACTCAGATTGG - Intronic
1129480074 15:75816901-75816923 TGTGACTAAAATTCCCAGATGGG + Intergenic
1132132259 15:99293295-99293317 TGTCTGTAAAATACTAAGGTTGG + Intronic
1135765193 16:25171548-25171570 TTTCACTAAAATAATCAGTTTGG - Intronic
1139127902 16:64103403-64103425 TGTAAATAAATTATTGAGGTAGG - Intergenic
1139598822 16:67974008-67974030 TCTCACTAAATTGCTCAGGTTGG + Intergenic
1148197506 17:45725071-45725093 TGTAAGTAAATTTCTCAGTTTGG + Intergenic
1149747211 17:59110080-59110102 TTTAACTTGAATATTCAGGTAGG + Exonic
1150911927 17:69396925-69396947 TGTAAATAGAAGAGTCAGGTCGG - Intergenic
1154983877 18:21529097-21529119 TGTTACTAAAATAATCAGAAAGG + Intergenic
1156107194 18:33677618-33677640 TGTAACGAAAACATGCAGGTAGG - Intronic
1159018244 18:63120355-63120377 TTTAAATAAAATACTCCGCTGGG + Intergenic
1159429831 18:68337288-68337310 TGTAACTAAAACACTCCAGCTGG + Intergenic
1165816577 19:38646176-38646198 TGCAAATAAACTACTCAGGTAGG - Intergenic
1166665196 19:44675588-44675610 TGTCACTAAATTACTTAGGCTGG - Intronic
925051726 2:820776-820798 TCTCACTAAAATCCTCATGTGGG + Intergenic
926164831 2:10514967-10514989 TGTAATGAAAAAACTCAGATTGG - Intergenic
928044739 2:27918010-27918032 AGTAATTAAAATACTCATGTTGG - Intronic
929753591 2:44742972-44742994 AGTAACTAAAAACCTCTGGTTGG + Intronic
934629122 2:95896429-95896451 TGTGTCTAAAATACTCTTGTTGG + Intronic
934629537 2:95902045-95902067 TGTGTCTAAAATACTCTTGTTGG + Intronic
934629952 2:95907661-95907683 TGTGTCTAAAATACTCTTGTTGG + Intronic
934630356 2:95913274-95913296 TGTGTCTAAAATACTCTTGTTGG + Intronic
934804670 2:97208821-97208843 TGTGTCTAAAATAGTCTGGTTGG - Intronic
936528378 2:113257819-113257841 TGCATTTAAAATACTCAGCTTGG - Intronic
939516594 2:143176707-143176729 TGTAAGTTAAATACACAGTTGGG - Intronic
940000732 2:148964332-148964354 TGTAACTTAAAGGCTCATGTAGG - Intronic
940146720 2:150552877-150552899 TGGAACTAAAATATGCAGATAGG - Intergenic
941332533 2:164196202-164196224 TGTAAATAATATAATCAGTTGGG + Intergenic
941409468 2:165135963-165135985 AGTAACTGAAATAATGAGGTGGG - Intronic
941872153 2:170397405-170397427 TTTCACAAAAATACTCAGGCAGG - Intronic
942832032 2:180248481-180248503 TGTGAATAAAACACTCAGCTTGG + Intergenic
943276573 2:185875820-185875842 CATAGCCAAAATACTCAGGTAGG - Intergenic
943658831 2:190535970-190535992 AGTAGCTAAAATAAACAGGTGGG + Intergenic
944874962 2:203953755-203953777 TAAAACTAAAATACTAACGTTGG - Intronic
946797504 2:223371656-223371678 TGTTAAGAAAATACTCAAGTGGG + Intergenic
947086180 2:226455194-226455216 GCTAACTAAAATAATCAGTTTGG + Intergenic
1170550080 20:17468923-17468945 TGGAAAAAAAATACTCAGCTTGG - Intronic
1173441222 20:43077975-43077997 TGTATCTGATATACTCAGGGAGG - Intronic
1174964127 20:55192261-55192283 TGTACCAAAAATACTAAGGTAGG - Intergenic
1177573827 21:22924781-22924803 TATAACTAAAATTCTCTGGTGGG + Intergenic
1178729652 21:35089070-35089092 TGTAGTGAAAATAGTCAGGTTGG + Intronic
1180737788 22:18031520-18031542 TCTAAGTAAAATACTAATGTTGG - Intergenic
1181483593 22:23217088-23217110 TGTAACTAAAATCCTGTGGTGGG - Intronic
1185287488 22:50009059-50009081 TGTAACTAAAATAAAGGGGTGGG + Exonic
949719014 3:6967078-6967100 AGTCAATAAAATACTGAGGTGGG - Intronic
951179935 3:19647710-19647732 TATATCTAAAAGAGTCAGGTTGG - Intergenic
951667991 3:25148118-25148140 TGTAACTTACATACCCAGTTAGG - Intergenic
952221671 3:31329442-31329464 AGTAACTGAAATAATGAGGTTGG + Intergenic
955298909 3:57758050-57758072 TGTAATTAAAAGCCTCAGGAGGG + Intronic
956428415 3:69160253-69160275 CTTAACTAAATTACTGAGGTGGG - Intergenic
957307167 3:78472605-78472627 TTTAACTAAAATATTCACATAGG - Intergenic
958520020 3:95172394-95172416 TGTTAATAAATTACTCTGGTAGG + Intergenic
958729398 3:97945446-97945468 TGTGTCTAAAATACTCATGAGGG - Intronic
959271371 3:104214876-104214898 TGAAGCTGAAATACTCTGGTGGG + Intergenic
959862114 3:111228363-111228385 TGTAACAAAACTTCTCATGTGGG + Intronic
963400672 3:144793432-144793454 TCTACCTTAAATAATCAGGTTGG + Intergenic
963511015 3:146249734-146249756 AGTAACAAAAATATTCAGTTAGG + Intronic
966775633 3:183540728-183540750 TGTAAGTTAAACTCTCAGGTAGG - Intronic
967061173 3:185874057-185874079 TGTCATTAAAATACTGAGATAGG - Intergenic
968042248 3:195598576-195598598 TGTCACTAAAATCCTAAGGCTGG - Intergenic
968352738 3:198074337-198074359 AGTAAGTGAAGTACTCAGGTGGG + Intergenic
970977087 4:22054610-22054632 TGTAACTAAAGTACTCTGGCTGG - Intergenic
972901431 4:43689182-43689204 TAAAACTAAAGTACTTAGGTAGG - Intergenic
973344250 4:49037177-49037199 TATAACTGAGATACTTAGGTGGG - Intronic
977560487 4:98528434-98528456 TGTCACTAAAACACTGATGTAGG + Intronic
978824920 4:113010722-113010744 TCTACCTAAAATACTCTGTTTGG - Intronic
980749563 4:137070797-137070819 TGTAGCTAAAATGCTCAGTAGGG + Intergenic
984351606 4:178601373-178601395 TGGAACTACCATACTCAGCTTGG - Intergenic
985944375 5:3165795-3165817 TGCAACTAAAATAATCAAGATGG + Intergenic
988342442 5:29990717-29990739 TGTAGCTAAGATACTCATCTCGG + Intergenic
989572134 5:42954533-42954555 TGTCACTAAAATGCTCTGCTGGG - Intergenic
989795378 5:45464739-45464761 TATAACTAAGATACTCTGGCAGG + Intronic
989817584 5:45755012-45755034 TATAACTAAAATACTAAAATAGG - Intergenic
990747137 5:58969905-58969927 TGTAGCAAAATTACTCAAGTTGG + Exonic
993564015 5:89450244-89450266 TGAAACTGAAATACTCAGTCTGG - Intergenic
993757491 5:91750083-91750105 TGTAACTAACATAACCAGTTTGG - Intergenic
993850767 5:93005411-93005433 TGTAACTTAAATATTCTGGTAGG - Intergenic
996393626 5:122989984-122990006 GTTCACTAAAATACACAGGTAGG - Intronic
997079432 5:130721388-130721410 TCTAGGTAAGATACTCAGGTAGG - Intergenic
1000408277 5:160911790-160911812 TGTATCTAAAATAACCAGGCTGG - Intergenic
1001168859 5:169397519-169397541 TGTGGCTAAAATAATCAGGAGGG - Intergenic
1002977401 6:2095314-2095336 AGTAACTAAAATACTCAGTGGGG + Intronic
1004039500 6:11961674-11961696 TGTAACCCAAATGCTCAGTTTGG - Intergenic
1005516060 6:26555380-26555402 TTTAACTTATATACTAAGGTTGG - Intergenic
1005527480 6:26665056-26665078 TGTAATTCAAATACTCATCTGGG - Intergenic
1007689456 6:43690071-43690093 TGTAAGAAAAATACACAGGCTGG + Intergenic
1009911268 6:69931195-69931217 TCTCACAAAAATACACAGGTGGG - Intronic
1011954079 6:93003527-93003549 TGAAAATAAAACACTCATGTTGG - Intergenic
1012415756 6:99011372-99011394 TGCAACAAAAATCCTCTGGTTGG + Intergenic
1012999725 6:106010017-106010039 GGTAACTCAAATATTCAGGAAGG - Intergenic
1020456304 7:8377167-8377189 TGAAATCAAAAGACTCAGGTGGG - Intergenic
1021004483 7:15376417-15376439 TGTAACTAATATTTTCATGTTGG - Intronic
1021050555 7:15979422-15979444 TGATAATAAAATATTCAGGTGGG - Intergenic
1021630971 7:22647082-22647104 AGTATCTAAAATACAAAGGTGGG + Intergenic
1023370753 7:39509931-39509953 TGCAACAGAAATACTAAGGTAGG + Intergenic
1026087687 7:67275892-67275914 TGTAATTCAAAAACTGAGGTGGG - Intergenic
1026726545 7:72874339-72874361 TGTAATTCAAAAACTAAGGTGGG + Intergenic
1027117295 7:75491271-75491293 TGTAATTCAAAAACTGAGGTGGG - Intergenic
1027274514 7:76544331-76544353 TGTAATTCAAAAACTGAGGTGGG + Intergenic
1028999301 7:97136478-97136500 TGGAACTAAAATAATCTGGCAGG - Intronic
1030056176 7:105585592-105585614 TGTAAATAATATATTCAGTTTGG - Intronic
1030834156 7:114262751-114262773 TGCAAATAAATTCCTCAGGTGGG - Intronic
1031592008 7:123604689-123604711 TGTAAATAAAATTTACAGGTGGG + Intronic
1031753647 7:125611286-125611308 AGTAACAAAAAAAATCAGGTAGG + Intergenic
1033982075 7:147177957-147177979 TGTAAGTATTATAGTCAGGTGGG - Intronic
1036139890 8:6197846-6197868 TCTCACTAAAATACTGAGTTAGG - Intergenic
1036827750 8:11991380-11991402 TGTAGCAAAATTTCTCAGGTGGG + Intergenic
1036950008 8:13132046-13132068 TGTTACGAAAATAGTCGGGTCGG + Intronic
1040397625 8:47014515-47014537 TCTCACTATAACACTCAGGTTGG - Intergenic
1041369833 8:57147634-57147656 TGTAACTTAAAAAGTAAGGTGGG + Intergenic
1042517196 8:69671927-69671949 TGTAACTAAAATACTCAGGTGGG + Exonic
1042613454 8:70623225-70623247 TGTGACTAAAAAACAAAGGTGGG + Intronic
1044528058 8:93274798-93274820 TGTAACTAAAATTCTTAGCATGG - Intergenic
1044625210 8:94230059-94230081 TGTTACTAAAATACTAAAGACGG + Intergenic
1046411253 8:113845983-113846005 AGTAACTTAATTACTCAGGTAGG - Intergenic
1047344268 8:124011679-124011701 TGTAACTATGCTACTCAGGCTGG + Intronic
1052873439 9:33531599-33531621 AGTAAGTGAAGTACTCAGGTGGG - Intronic
1053502661 9:38613147-38613169 AGTAAGTGAAGTACTCAGGTGGG + Intergenic
1057153427 9:92816489-92816511 AGTAAGTGAAGTACTCAGGTGGG - Intergenic
1059032765 9:110717799-110717821 TGTAACTATAATTCTTTGGTAGG + Intronic
1059944416 9:119394347-119394369 TATGACAAAAATACACAGGTGGG + Intergenic
1060379029 9:123147932-123147954 TGTATCTAACATGTTCAGGTAGG + Intronic
1061424618 9:130491254-130491276 TGTAACTAAAATCCTCCTTTCGG - Intronic
1188819523 X:34757145-34757167 TGTAACTGAAAAACTCATTTAGG + Intergenic
1189511229 X:41663692-41663714 TATAACTCAAAAACGCAGGTGGG + Intronic
1192538219 X:71946740-71946762 GGTAAGTAAAATAATCTGGTTGG + Intergenic
1199224076 X:145352146-145352168 CTGAACTAAAATAATCAGGTTGG - Intergenic
1200944316 Y:8817341-8817363 TGTAACAGGAATAGTCAGGTGGG - Intergenic