ID: 1042517280

View in Genome Browser
Species Human (GRCh38)
Location 8:69672883-69672905
Sequence GGAAGAGAGCCCCGCTGCCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 142}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042517280_1042517290 13 Left 1042517280 8:69672883-69672905 CCAAGGCAGCGGGGCTCTCTTCC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1042517290 8:69672919-69672941 CAGAGGAACTTATTGCTTCTGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1042517280_1042517291 17 Left 1042517280 8:69672883-69672905 CCAAGGCAGCGGGGCTCTCTTCC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1042517291 8:69672923-69672945 GGAACTTATTGCTTCTGGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 173
1042517280_1042517283 -4 Left 1042517280 8:69672883-69672905 CCAAGGCAGCGGGGCTCTCTTCC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1042517283 8:69672902-69672924 TTCCAGCCCCGGGTCCGCAGAGG 0: 1
1: 0
2: 12
3: 19
4: 145
1042517280_1042517293 24 Left 1042517280 8:69672883-69672905 CCAAGGCAGCGGGGCTCTCTTCC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1042517293 8:69672930-69672952 ATTGCTTCTGGGAAGGGCCCCGG 0: 1
1: 0
2: 5
3: 53
4: 441
1042517280_1042517289 12 Left 1042517280 8:69672883-69672905 CCAAGGCAGCGGGGCTCTCTTCC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1042517289 8:69672918-69672940 GCAGAGGAACTTATTGCTTCTGG 0: 1
1: 0
2: 4
3: 10
4: 140
1042517280_1042517295 29 Left 1042517280 8:69672883-69672905 CCAAGGCAGCGGGGCTCTCTTCC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1042517295 8:69672935-69672957 TTCTGGGAAGGGCCCCGGGTAGG 0: 1
1: 0
2: 2
3: 17
4: 202
1042517280_1042517294 25 Left 1042517280 8:69672883-69672905 CCAAGGCAGCGGGGCTCTCTTCC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1042517294 8:69672931-69672953 TTGCTTCTGGGAAGGGCCCCGGG 0: 1
1: 0
2: 15
3: 159
4: 884
1042517280_1042517292 18 Left 1042517280 8:69672883-69672905 CCAAGGCAGCGGGGCTCTCTTCC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1042517292 8:69672924-69672946 GAACTTATTGCTTCTGGGAAGGG 0: 1
1: 0
2: 2
3: 11
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042517280 Original CRISPR GGAAGAGAGCCCCGCTGCCT TGG (reversed) Exonic