ID: 1042517805

View in Genome Browser
Species Human (GRCh38)
Location 8:69677967-69677989
Sequence GACCCATGGGTGAGCTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042517797_1042517805 4 Left 1042517797 8:69677940-69677962 CCCCCTAATCTGGGCAGAAGCTG 0: 1
1: 0
2: 1
3: 18
4: 446
Right 1042517805 8:69677967-69677989 GACCCATGGGTGAGCTCTTCTGG No data
1042517789_1042517805 28 Left 1042517789 8:69677916-69677938 CCTAATCCCCTTCCCTGCACTGC 0: 1
1: 0
2: 4
3: 53
4: 500
Right 1042517805 8:69677967-69677989 GACCCATGGGTGAGCTCTTCTGG No data
1042517800_1042517805 1 Left 1042517800 8:69677943-69677965 CCTAATCTGGGCAGAAGCTGCCC 0: 1
1: 0
2: 1
3: 22
4: 360
Right 1042517805 8:69677967-69677989 GACCCATGGGTGAGCTCTTCTGG No data
1042517792_1042517805 20 Left 1042517792 8:69677924-69677946 CCTTCCCTGCACTGCACCCCCTA 0: 2
1: 0
2: 7
3: 57
4: 549
Right 1042517805 8:69677967-69677989 GACCCATGGGTGAGCTCTTCTGG No data
1042517799_1042517805 2 Left 1042517799 8:69677942-69677964 CCCTAATCTGGGCAGAAGCTGCC 0: 1
1: 0
2: 1
3: 10
4: 191
Right 1042517805 8:69677967-69677989 GACCCATGGGTGAGCTCTTCTGG No data
1042517790_1042517805 22 Left 1042517790 8:69677922-69677944 CCCCTTCCCTGCACTGCACCCCC 0: 1
1: 0
2: 8
3: 124
4: 908
Right 1042517805 8:69677967-69677989 GACCCATGGGTGAGCTCTTCTGG No data
1042517788_1042517805 29 Left 1042517788 8:69677915-69677937 CCCTAATCCCCTTCCCTGCACTG 0: 1
1: 0
2: 0
3: 38
4: 341
Right 1042517805 8:69677967-69677989 GACCCATGGGTGAGCTCTTCTGG No data
1042517791_1042517805 21 Left 1042517791 8:69677923-69677945 CCCTTCCCTGCACTGCACCCCCT 0: 1
1: 0
2: 6
3: 61
4: 711
Right 1042517805 8:69677967-69677989 GACCCATGGGTGAGCTCTTCTGG No data
1042517798_1042517805 3 Left 1042517798 8:69677941-69677963 CCCCTAATCTGGGCAGAAGCTGC 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1042517805 8:69677967-69677989 GACCCATGGGTGAGCTCTTCTGG No data
1042517794_1042517805 15 Left 1042517794 8:69677929-69677951 CCTGCACTGCACCCCCTAATCTG 0: 1
1: 0
2: 2
3: 7
4: 147
Right 1042517805 8:69677967-69677989 GACCCATGGGTGAGCTCTTCTGG No data
1042517793_1042517805 16 Left 1042517793 8:69677928-69677950 CCCTGCACTGCACCCCCTAATCT 0: 1
1: 1
2: 2
3: 17
4: 163
Right 1042517805 8:69677967-69677989 GACCCATGGGTGAGCTCTTCTGG No data
1042517787_1042517805 30 Left 1042517787 8:69677914-69677936 CCCCTAATCCCCTTCCCTGCACT 0: 1
1: 0
2: 1
3: 28
4: 530
Right 1042517805 8:69677967-69677989 GACCCATGGGTGAGCTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042517805 Original CRISPR GACCCATGGGTGAGCTCTTC TGG Intronic
No off target data available for this crispr