ID: 1042518108

View in Genome Browser
Species Human (GRCh38)
Location 8:69681170-69681192
Sequence ACCATCCACTGAATGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042518108 Original CRISPR ACCATCCACTGAATGTTTTG GGG (reversed) Intronic
901449324 1:9326386-9326408 ACCACCCACTGACTTTTCTGTGG - Intronic
905905540 1:41615696-41615718 ACCATCCCATGATTGTTTTCTGG - Intronic
905937147 1:41833765-41833787 ACCACCCACAGAATGACTTGGGG - Intronic
908375314 1:63531449-63531471 ACCATCCACTTAATTGTTTGGGG - Intronic
909008513 1:70305732-70305754 CCAATCCAGTGAATATTTTGAGG - Intronic
909530561 1:76677470-76677492 ACCATTTACTTAATCTTTTGTGG - Intergenic
918852062 1:189705163-189705185 ACTAGCCAATGGATGTTTTGGGG - Intergenic
918913982 1:190610905-190610927 TCCATCCACTGAAATTGTTGTGG - Intergenic
922155989 1:223039954-223039976 ACCCTCCACTGAATGTTCATTGG - Intergenic
924148236 1:241099825-241099847 ACTATTGACTGAATTTTTTGAGG - Intronic
1062988964 10:1797254-1797276 ACCATACAATGAAAGTTTTTTGG + Intergenic
1065350363 10:24790188-24790210 ACTATCCAGTGACTGTTTTGAGG + Intergenic
1068931028 10:62590490-62590512 ACTATGCACTCAATGTTATGCGG + Intronic
1071106644 10:82105624-82105646 GTCATCCTCTGAATGATTTGAGG + Intronic
1074353569 10:112761116-112761138 ACCATGGACTGTATGTCTTGAGG + Intronic
1075199578 10:120391245-120391267 ACCACCCAGGCAATGTTTTGGGG + Intergenic
1075477915 10:122752608-122752630 ACCATCCACAAATGGTTTTGTGG + Intergenic
1078260996 11:9708749-9708771 ATCTTCCACTTAGTGTTTTGTGG + Intronic
1079723806 11:23853640-23853662 GCAATACATTGAATGTTTTGTGG + Intergenic
1081467120 11:43331245-43331267 ACCAGCCAGTGGTTGTTTTGGGG - Intronic
1084131290 11:67137524-67137546 ACTTTTCATTGAATGTTTTGAGG + Intronic
1085736032 11:79039968-79039990 CCTATTCACTGAATCTTTTGGGG + Intronic
1086451827 11:86924768-86924790 ACCGTTCACTAAAGGTTTTGGGG - Intronic
1088537521 11:110877236-110877258 ACCAGCCAATGAAAGCTTTGTGG - Intergenic
1097913030 12:64990857-64990879 GCCATCCACTGAGTGTTGAGTGG + Intergenic
1100819258 12:98416002-98416024 CCCAAACACTGAATGTTTGGTGG + Intergenic
1103459414 12:121091882-121091904 ACCATCCATTGAAGGTGCTGTGG - Intergenic
1106324206 13:28672370-28672392 ATCTTTCACTGGATGTTTTGAGG + Exonic
1108419230 13:50232078-50232100 ACCTGCCTCTGAATGTTCTGTGG + Intronic
1109937617 13:69312111-69312133 ACCTTCAAGTGCATGTTTTGAGG + Intergenic
1111015976 13:82382702-82382724 ATAATAAACTGAATGTTTTGCGG + Intergenic
1117391558 14:55267464-55267486 ACCACCTTCTGAATGTTCTGAGG + Intergenic
1121550418 14:94795504-94795526 ACCATCCTCTGAGTGCTTGGGGG + Intergenic
1125369964 15:38964345-38964367 ACTATCCTCGCAATGTTTTGAGG - Intergenic
1126343925 15:47673519-47673541 ATCTTCCACTGAATGTTTTCTGG - Intronic
1126724589 15:51619160-51619182 ACCCTTCAGTGAATGTTTTGAGG - Intronic
1127220872 15:56879549-56879571 ACCATCCACTTCATTTTATGAGG + Intronic
1133707613 16:8370129-8370151 ACCATACACTGAATCTGCTGGGG - Intergenic
1137281012 16:46976658-46976680 TCCAGCCACTAACTGTTTTGAGG + Intergenic
1145211875 17:21019656-21019678 ACCACTCTCTGAATATTTTGTGG - Intronic
1147856578 17:43484956-43484978 ACCAGTCACTAGATGTTTTGGGG + Intronic
1149750831 17:59143770-59143792 AACATCCAGTTAAAGTTTTGGGG - Intronic
1158401429 18:57124892-57124914 ACTATGCACTGCATTTTTTGTGG - Intergenic
1167214938 19:48158259-48158281 AACATCCACTTAATGTTGAGTGG + Intronic
925095302 2:1193759-1193781 ACCATCTACTGCATGTTTCTAGG + Intronic
926375223 2:12220388-12220410 ACCATTCATTAAATATTTTGAGG + Intergenic
928512168 2:32011724-32011746 TACATCCAATGAAAGTTTTGGGG + Intronic
928780732 2:34815577-34815599 AACATCCATTGTTTGTTTTGGGG + Intergenic
942409707 2:175695927-175695949 ATCAACCTCTGAATCTTTTGAGG - Intergenic
942654116 2:178196423-178196445 TCCATCCACTGAATGTATAATGG - Intronic
945290620 2:208124059-208124081 ACCATCCAGTGAGTGTCCTGAGG + Intronic
945672675 2:212820924-212820946 ACCAGTCACTGTCTGTTTTGTGG + Intergenic
948885882 2:240884360-240884382 ACCATGAGCTGAATGTTATGGGG - Intergenic
1170900984 20:20462915-20462937 AGCATCCACAGAACGTTTAGTGG - Intronic
1173164668 20:40678924-40678946 ACGATCCAATGAATGGTTTTAGG + Intergenic
1174417693 20:50378356-50378378 ACCATTCACTGTTTGCTTTGGGG - Intergenic
1177053086 21:16263408-16263430 ACCATCCTCTAAAAGTTTTGAGG - Intergenic
1177664432 21:24135716-24135738 ACCATCCACTAACAGTTTTTAGG + Intergenic
1179342463 21:40525764-40525786 AAAATTCACTTAATGTTTTGAGG + Intronic
1181896468 22:26112408-26112430 TTCATCCATTGAATATTTTGGGG + Intergenic
1183564598 22:38604487-38604509 ACCATCCACTGAGGTTTGTGGGG + Intronic
949647886 3:6118849-6118871 TCCCTGCACTGAATGATTTGAGG - Intergenic
951497132 3:23342337-23342359 ACCATCCATCAAATCTTTTGTGG + Intronic
952298811 3:32085852-32085874 ACAAGCCACTGGATGTTGTGAGG - Intergenic
952919022 3:38271950-38271972 ACCATCCACTGTGGGTGTTGGGG + Intronic
954977278 3:54708169-54708191 ACCATCCAGTGAAACTTTTCTGG + Intronic
960518001 3:118623477-118623499 ACCTTCCACTGCAGGCTTTGGGG - Intergenic
960602392 3:119470772-119470794 AGCATCCAAGGAATTTTTTGAGG - Intronic
960830879 3:121846509-121846531 ACCAACCACTGAATTTTAAGAGG + Intronic
965330384 3:167366354-167366376 TAGATCCACTGAATATTTTGGGG - Intronic
965473763 3:169129050-169129072 TTCATTGACTGAATGTTTTGGGG + Intronic
965643109 3:170852579-170852601 AAAATCCACTGTATGTGTTGTGG + Intronic
968535003 4:1119636-1119658 ATCATACACTGTATGTTTTCAGG + Intergenic
971666325 4:29490491-29490513 ATCATACACTGAATGTTTTACGG - Intergenic
977215122 4:94273272-94273294 AATATCCACTGAATGGTTTAAGG - Intronic
980298757 4:130959847-130959869 ACCCACCACAGAAAGTTTTGAGG - Intergenic
982644429 4:158005450-158005472 TCCATCCAATGGAAGTTTTGTGG + Intergenic
983273108 4:165586584-165586606 ACTATGCACTGCATGCTTTGTGG - Intergenic
983784274 4:171712846-171712868 AACATCCACAGAATGTTTAGAGG - Intergenic
984671695 4:182496885-182496907 AACATACCCTGAATGTTTTCTGG + Intronic
990890194 5:60640399-60640421 ACCATGCACTGATTTTTTTTAGG - Intronic
996413388 5:123183207-123183229 ACCCTCAACTGTATGTCTTGGGG + Intronic
996999146 5:129738543-129738565 ACAATCCAATGTATGTTCTGAGG + Exonic
999855002 5:155584779-155584801 ACCATCTACTGACTGTGTTAAGG - Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001229538 5:169974215-169974237 AACATCTACTGAAAGTTTGGAGG + Intronic
1005073287 6:21882463-21882485 ATCTTCCACTGTAGGTTTTGGGG - Intergenic
1005530349 6:26698260-26698282 ACTGTCCACTGAACGTTTTAGGG - Intergenic
1005540447 6:26803386-26803408 ACTGTCCACTGAACGTTTTAGGG + Intergenic
1008420266 6:51291104-51291126 ATCAGTCCCTGAATGTTTTGGGG + Intergenic
1009011262 6:57845484-57845506 ACTGTCCACTGAACGTTTTAGGG + Intergenic
1010729785 6:79379179-79379201 ACGATCCACTGAAATTTTTCAGG - Intergenic
1011007190 6:82659170-82659192 AGCATGCACTAAATGTTTTATGG - Intergenic
1012686931 6:102262269-102262291 ACCATCTAATGTATGTTTTATGG + Intergenic
1013379059 6:109548547-109548569 ACCATCCACTTAAATTTGTGAGG + Intronic
1013804495 6:113982355-113982377 AACATCCAGTGAATTTGTTGGGG + Intronic
1014305028 6:119729172-119729194 ACATTCCACTTAATGTTTTCAGG - Intergenic
1014341855 6:120219400-120219422 ATCATACACAGAATGTTTTCAGG - Intergenic
1014836931 6:126170411-126170433 AACATCCACTGAATTTTCTATGG - Intergenic
1015126836 6:129764412-129764434 GCCATCTACTGAATGTTCTTGGG + Intergenic
1017573784 6:155778887-155778909 ACCATCCACTGAAGTTCTTAAGG - Intergenic
1018392906 6:163354010-163354032 ACCATCCTCTGAATGTTTGAAGG + Intergenic
1021255650 7:18389278-18389300 ATTATCCACTGATTATTTTGTGG - Intronic
1021883712 7:25118105-25118127 ATCATTCAGTGAATCTTTTGAGG + Intergenic
1026328110 7:69328476-69328498 CCCATCATCTGACTGTTTTGTGG - Intergenic
1026420599 7:70233065-70233087 GCAATCAAATGAATGTTTTGAGG - Intronic
1027748944 7:82116517-82116539 ACCTTCCTCTCAATGTATTGTGG - Intronic
1028706938 7:93859880-93859902 TCCATCCAGTGAATTATTTGTGG - Intronic
1028798911 7:94938280-94938302 ACCTGCCCCTGAATTTTTTGTGG + Intronic
1031848857 7:126839094-126839116 ACCATACACTGCATGATTTTTGG + Intronic
1032864701 7:135914108-135914130 ACCATCCACTGGATGTTGGAGGG - Intergenic
1035159150 7:156938479-156938501 TGCAGCCACTGAATGATTTGAGG + Intergenic
1037295162 8:17391838-17391860 AACCCCCACTTAATGTTTTGTGG - Intronic
1038853564 8:31305385-31305407 ACCATCCACTTCAATTTTTGAGG - Intergenic
1039082629 8:33747844-33747866 ACCAGCCACTGAATTCTATGAGG + Intergenic
1039862814 8:41473628-41473650 ACCACCCTCTGTATGATTTGGGG + Intergenic
1042291645 8:67175043-67175065 AACATCCACTGCTTGTTCTGGGG + Intronic
1042518108 8:69681170-69681192 ACCATCCACTGAATGTTTTGGGG - Intronic
1043683190 8:83057279-83057301 AACATCCTTTGAATGGTTTGAGG + Intergenic
1044124611 8:88441871-88441893 ACCTTCCTCAGAATGTTATGTGG + Intergenic
1044579690 8:93812635-93812657 ACAATCCTCTAAAAGTTTTGTGG + Intronic
1047541938 8:125776225-125776247 ATCATCCACAGCATGCTTTGTGG + Intergenic
1054871901 9:70054778-70054800 ACCCTCCACTGAGTGGCTTGTGG + Intronic
1056133224 9:83605757-83605779 AACATCCACTGAATATGCTGAGG - Intergenic
1060522131 9:124300006-124300028 ACCTTCCACAGACTGTTCTGGGG - Intronic
1186601215 X:11039391-11039413 ACCATCCATTGACTGATTAGGGG - Intergenic
1187090192 X:16088243-16088265 TCTATCCACTGAAGGTTTTCTGG + Intergenic
1189557822 X:42163777-42163799 ACCATGCCCTAAAAGTTTTGAGG - Intergenic
1191125307 X:56947762-56947784 ACCATGCCCTAAAAGTTTTGAGG + Intergenic
1192272235 X:69592189-69592211 ATAATCCACTTAATATTTTGTGG - Intergenic
1193605296 X:83559994-83560016 ACCTTTCACTGGATATTTTGAGG - Intergenic
1196337496 X:114554725-114554747 AAGATCTACTGAATATTTTGGGG - Intergenic
1196984647 X:121254538-121254560 AGCATCAGCTGAGTGTTTTGAGG + Intergenic