ID: 1042522616

View in Genome Browser
Species Human (GRCh38)
Location 8:69729905-69729927
Sequence TGTATTGGTCTACTTTACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042522616_1042522618 19 Left 1042522616 8:69729905-69729927 CCACTGTAAAGTAGACCAATACA 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1042522618 8:69729947-69729969 AACCTAACAAGATTTCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042522616 Original CRISPR TGTATTGGTCTACTTTACAG TGG (reversed) Intronic
901428019 1:9195698-9195720 TGTCTCGGTCAACTTGACAGAGG - Intergenic
907588920 1:55647121-55647143 TTCATTTTTCTACTTTACAGAGG + Intergenic
911271125 1:95802526-95802548 TGTGTTGGTCTTCTTTTGAGAGG - Intergenic
913596809 1:120386461-120386483 TGTATGGGTATACATTAAAGGGG + Intergenic
914090459 1:144492520-144492542 TGTATGGGTATACATTAAAGGGG - Intergenic
914308148 1:146441702-146441724 TGTATGGGTATACATTAAAGGGG + Intergenic
914593958 1:149131431-149131453 TGTATGGGTATACATTAAAGGGG - Intergenic
917004876 1:170403293-170403315 TGCAATGGACTACTGTACAGCGG - Intergenic
918405764 1:184210417-184210439 TGTATTGGTCAGCTTTACTGTGG - Intergenic
918962097 1:191293286-191293308 TGTCTTGGTAAACTTTTCAGAGG + Intergenic
920384325 1:205557699-205557721 TGTATTTGTATAGTTTCCAGGGG - Intergenic
922252346 1:223861233-223861255 TGTATTAGTCTTCTCTACACTGG + Intergenic
1063088476 10:2840516-2840538 TGTGTTGGCCAAGTTTACAGGGG + Intergenic
1065431886 10:25666959-25666981 TTTATTGTTCTACTTTATAATGG + Intergenic
1069089110 10:64177759-64177781 TGTATTGCTAAACATTACAGAGG - Intergenic
1069515058 10:69070692-69070714 TGCCTTGGTCTTCTTTAAAGAGG - Intergenic
1070352568 10:75607506-75607528 TGTAGTGCTCTAATTTATAGTGG + Intronic
1070393959 10:75995519-75995541 TGACTTGGTCAAGTTTACAGAGG - Intronic
1073253226 10:102134409-102134431 GTTATTGTTCTACTCTACAGTGG + Intronic
1075622039 10:123935073-123935095 TGTCTTGGTCTCCTCTGCAGAGG + Intronic
1076298768 10:129408002-129408024 TTTATGGGTCTTCTTTACATAGG - Intergenic
1081244082 11:40742721-40742743 TTTTCTGTTCTACTTTACAGTGG + Intronic
1086433169 11:86755697-86755719 TTTATTCTTCTATTTTACAGAGG - Intergenic
1087125117 11:94617829-94617851 TGTATTGCCCTATTTTACAGTGG + Intronic
1090015627 11:123083950-123083972 TGTTTTGGTCAACTTTTGAGTGG + Intronic
1093610169 12:21146193-21146215 TATATTGGTCTATTTTATATAGG + Intronic
1099711134 12:86225867-86225889 TGTCTTGTTCTAATTTTCAGAGG - Intronic
1104319602 12:127738382-127738404 TGGCTTGGGCTGCTTTACAGAGG - Intergenic
1109651140 13:65328251-65328273 ATTATTGATCTACTTTATAGGGG - Intergenic
1110742405 13:79013160-79013182 TGTCTTGTTCTAATTTTCAGTGG + Intergenic
1110879644 13:80556008-80556030 TGTAGTGGTTTTCTTTAAAGTGG - Intergenic
1112805944 13:103163895-103163917 TGTATTGGTCTTCTTCTCACTGG - Intergenic
1112819579 13:103315684-103315706 TTTATTGGTCTACTTTTGACAGG - Intergenic
1116299371 14:43158021-43158043 TGTGTTGGTCTACATTACTGAGG - Intergenic
1117757749 14:58993125-58993147 TGTCTTGGTCTGCTTCTCAGAGG + Intergenic
1123152098 14:106192537-106192559 TGTATTAGTCTATTTTACATTGG + Intergenic
1123400481 15:19980483-19980505 TGTATTAGTCTATTTTACATTGG + Intergenic
1124029804 15:26000326-26000348 TGTTTTTGTCTTCTTTACAGGGG + Intergenic
1124918557 15:34000678-34000700 TATATTGGTTTACTTTCGAGAGG - Intronic
1129034327 15:72640520-72640542 GGTATCGGTCTCATTTACAGAGG - Intergenic
1129186940 15:73913832-73913854 TGTATGGCTCTACTTTTCACGGG + Intergenic
1129215555 15:74096696-74096718 GGTATCGGTCTCATTTACAGAGG + Intergenic
1129391865 15:75224764-75224786 GGTATCGGTCTCATTTACAGAGG - Intergenic
1133677061 16:8083584-8083606 TGTATTTGTATTCATTACAGAGG + Intergenic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1148527027 17:48348868-48348890 TGTCGTTGTGTACTTTACAGAGG - Intronic
1148807157 17:50269702-50269724 TGCCTGGGTCTACTTCACAGAGG - Intergenic
1154969175 18:21390096-21390118 TGCATTGCACTACTTTACAATGG - Intronic
1156613173 18:38751560-38751582 TGTCTAGGTCCACTTTCCAGGGG - Intergenic
1168398435 19:56068121-56068143 TGTATCTGGCTTCTTTACAGTGG - Intergenic
925605503 2:5655831-5655853 TGTATGGGTATACATTAAAGGGG + Intergenic
926715186 2:15918882-15918904 TGTCATGGGCTACTTTGCAGGGG - Intergenic
929848644 2:45559542-45559564 TATATCTGTCTAATTTACAGGGG + Intronic
930890431 2:56379387-56379409 TATATTGGTCATCATTACAGTGG + Intronic
932085121 2:68750952-68750974 TGTATTGTCCTATTTTCCAGGGG - Intronic
937583084 2:123512958-123512980 TGTATTGTTCCACTTTCCAGTGG + Intergenic
938674877 2:133622208-133622230 TGTCTTGGTCTAGTTCTCAGGGG - Intergenic
939339632 2:140877625-140877647 TGCATTTGCCTTCTTTACAGAGG + Intronic
941064278 2:160883403-160883425 TGTATTTGTCTAAGTGACAGTGG + Intergenic
944363095 2:198882147-198882169 AGTATTGGTTTATTTTACATAGG - Intergenic
945437586 2:209837715-209837737 TTTATTGGTCAACTTTAAAAAGG - Intronic
948768224 2:240234024-240234046 TGCATTGGTCACCTTAACAGCGG + Intergenic
948963766 2:241360115-241360137 TGTATTTGTCCACTATATAGGGG + Intronic
949029132 2:241781452-241781474 TGTTTTGGTCCTCTTTACGGTGG - Intronic
1170379790 20:15744981-15745003 TGTATTGATGTGCTTTAGAGTGG - Intronic
1175010340 20:55728390-55728412 TGTATTAGTCTATTTTGCATTGG + Intergenic
1175525627 20:59631497-59631519 TGTCTTGGTCCAGTTTACAGGGG + Intronic
1181520465 22:23446304-23446326 TGTCTTTCTGTACTTTACAGAGG + Intergenic
957191551 3:77016344-77016366 TGTATGGATCTGATTTACAGTGG - Intronic
957289283 3:78257660-78257682 TGTATTTGTCAATTTTCCAGAGG - Intergenic
957326528 3:78702778-78702800 TTTATTCGTCTACATAACAGTGG - Intronic
959599841 3:108169223-108169245 TGCATTGTTCTAATTAACAGTGG + Intronic
961960288 3:130847530-130847552 TTTATTGTGCTACTTTGCAGAGG + Intergenic
962354258 3:134680342-134680364 TGTTTTGGTGAACTTAACAGTGG - Intronic
963474965 3:145793447-145793469 TGTATTAGTCTACTTTCATGTGG + Intergenic
966281058 3:178229614-178229636 TATATTGGTCTACTTAATGGAGG + Intergenic
971941287 4:33218979-33219001 TGTATTGGTTGATTTTACAGAGG - Intergenic
973636518 4:52866139-52866161 TGTATTGATGTGATTTACAGTGG + Exonic
976122854 4:81801819-81801841 GGTATTTGTCTACCTTACGGTGG + Intronic
976455362 4:85240436-85240458 TGTCTTGTTCTACTTCTCAGAGG + Intergenic
977918544 4:102619714-102619736 TGTATTTTTTCACTTTACAGTGG - Intergenic
978255545 4:106688624-106688646 TGTATTCATCTACTTTACATAGG + Intergenic
979728602 4:123994460-123994482 TGTATTAGTCTCATTTAGAGAGG - Intergenic
981019486 4:140010331-140010353 TGTATAGGTGTGCTTAACAGTGG - Intronic
981233512 4:142387788-142387810 TGTATTGTTCTATCATACAGAGG + Intronic
981874655 4:149527647-149527669 TGTATTATTCTAATTTACACAGG + Intergenic
982078504 4:151763013-151763035 TGTGTTGCTCTCCCTTACAGTGG - Intergenic
983623391 4:169782922-169782944 TGTTATGGACTATTTTACAGGGG - Intergenic
987981897 5:25096479-25096501 TGTATTACTCTATTTTACAATGG + Intergenic
988933060 5:36055611-36055633 TTTAATGGTCCACATTACAGAGG - Intronic
989866009 5:46508604-46508626 TGCTTGGGTCTACTTTACATGGG - Intergenic
990763976 5:59161846-59161868 TCTCTTGGTCTTCTTTTCAGAGG + Intronic
992251528 5:74880794-74880816 TGTATTGGGCTGCTTTGCAATGG + Intergenic
993983599 5:94570682-94570704 TGTATTGGTTTATACTACAGGGG - Intronic
995637069 5:114205304-114205326 TTTACTGGGCTACTTTACAGTGG + Intergenic
996726502 5:126677369-126677391 TGCATTGGTGAAGTTTACAGGGG + Intergenic
998568588 5:143237641-143237663 TGTAGGGTTCTCCTTTACAGTGG - Intergenic
999508129 5:152219528-152219550 TGCATGGATCTACTGTACAGTGG - Intergenic
1000477331 5:161727401-161727423 TGTGTTGGTCTATTTTGCATTGG + Intergenic
1005244464 6:23866036-23866058 TGTATTGTTCCAGTTTTCAGGGG - Intergenic
1009751707 6:67884805-67884827 TGTTTTGGTGTCCTTTGCAGCGG + Intergenic
1011832709 6:91392719-91392741 AGTATTACTCTACTTTACCGGGG - Intergenic
1012008938 6:93754959-93754981 GGTATTGTTCTAGTTTCCAGTGG - Intergenic
1013531345 6:111021614-111021636 GGTATTGCTATAGTTTACAGAGG - Intronic
1013716216 6:112966507-112966529 TGTAATGGTATCCTTTACACTGG + Intergenic
1017090277 6:150753198-150753220 TAAAGTGGTCTACTTTACGGGGG - Intronic
1018308934 6:162488652-162488674 AGTATTGTTCTCATTTACAGAGG - Intronic
1018691942 6:166353524-166353546 TGGTTTGGTCTGCTTTACTGGGG - Intergenic
1019590775 7:1829923-1829945 TGTCTTTCTGTACTTTACAGAGG - Intronic
1019817046 7:3208978-3209000 TGAATTGGTCGTCTGTACAGTGG - Intergenic
1021466310 7:20947752-20947774 TGTCTTGTTCTAGTTTTCAGGGG - Intergenic
1021793921 7:24234121-24234143 TGTGTTGGACTAATTAACAGAGG + Intergenic
1027511678 7:79089938-79089960 TGTATAGGTATACCTTACATAGG - Intronic
1030816656 7:114047666-114047688 TGTATTGGGCTTCATTACATAGG - Intronic
1032273125 7:130429721-130429743 TGTACTGGACAGCTTTACAGAGG - Intronic
1033472004 7:141658676-141658698 TGTATAGGTCAACCTTGCAGAGG - Exonic
1033887897 7:145970625-145970647 TGTCTTGTTCCAGTTTACAGAGG - Intergenic
1035356528 7:158279195-158279217 TTGATTGGTCCATTTTACAGAGG + Intronic
1040430633 8:47338385-47338407 TGTATTCGTATATATTACAGTGG + Intronic
1041433179 8:57807388-57807410 TGTATTGGTCTACCATTCAGAGG + Intergenic
1042522616 8:69729905-69729927 TGTATTGGTCTACTTTACAGTGG - Intronic
1042765754 8:72320387-72320409 TGTCTTGAACTACTTTAAAGTGG + Intergenic
1043263749 8:78235853-78235875 TGTAGTGTTCTAATTCACAGGGG + Intergenic
1043705828 8:83349244-83349266 TGGTTCTGTCTACTTTACAGGGG - Intergenic
1044827633 8:96213528-96213550 TGTTTTGGTCTTCTGGACAGTGG - Intergenic
1045883662 8:107070394-107070416 TGCATTGGTATTGTTTACAGAGG + Intergenic
1046163965 8:110404548-110404570 TGTAATGGGCCACTTTACAGTGG - Intergenic
1046645290 8:116779175-116779197 TGAATTGGTATACTTTAAATGGG + Intronic
1052417381 9:28193881-28193903 TAGTTTGGTCTCCTTTACAGAGG + Intronic
1052682444 9:31710965-31710987 AGTGTTTGTCTATTTTACAGTGG + Intergenic
1056542095 9:87580762-87580784 CGTATATGTCTTCTTTACAGGGG - Intronic
1057176104 9:93000920-93000942 TATATTGATCTACTTGATAGTGG + Intronic
1185869400 X:3650947-3650969 TGTAGTGGTCCACGATACAGTGG + Intronic
1186941434 X:14512344-14512366 TGTCTTGTTCTAGTTTTCAGGGG - Intergenic
1187804004 X:23098113-23098135 TGTATTGTTCTAATTCTCAGGGG - Intergenic
1187849784 X:23580429-23580451 TGTATTGGTCCTCTATACTGGGG + Intergenic
1194001365 X:88433620-88433642 TGTCTTGGTCTAGTTCTCAGGGG + Intergenic
1196550282 X:117016316-117016338 TATATTAGTCTGCTTTACACTGG - Intergenic
1197646108 X:129018618-129018640 TGTCTTGTTCTACTTCTCAGGGG + Intergenic
1197755176 X:129988699-129988721 TGTTTTGGGCTTCTTTACCGTGG + Intronic
1200514803 Y:4131300-4131322 CTGATTGGTCTATTTTACAGAGG + Intergenic
1200836593 Y:7738348-7738370 AGCATTCCTCTACTTTACAGAGG + Intergenic
1200880258 Y:8205296-8205318 CTGATTGGTCCACTTTACAGAGG + Intergenic
1201743548 Y:17347795-17347817 CTGATTGGTCTGCTTTACAGAGG + Intergenic
1201949070 Y:19543028-19543050 TGTCTTGTTCTAGTTTACAAAGG + Intergenic