ID: 1042523020

View in Genome Browser
Species Human (GRCh38)
Location 8:69734248-69734270
Sequence TAGTGGCAAAGGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 1, 2: 2, 3: 54, 4: 432}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042523020_1042523031 23 Left 1042523020 8:69734248-69734270 CCCTCCACCCTCCTTTGCCACTA 0: 1
1: 1
2: 2
3: 54
4: 432
Right 1042523031 8:69734294-69734316 TGCTTTGCCTTTGCTCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042523020 Original CRISPR TAGTGGCAAAGGAGGGTGGA GGG (reversed) Intronic
900764497 1:4494798-4494820 AAGTGGCAAAGGGAGGAGGAGGG - Intergenic
902517304 1:16996353-16996375 TATGGGCAGAGGAGGGTGCAGGG + Intronic
903140271 1:21335075-21335097 CAGAGGCAGTGGAGGGTGGAGGG - Intronic
903213937 1:21832954-21832976 TGGAGGCAGAGGAGGGAGGAAGG + Intronic
904308189 1:29604180-29604202 AAGGGGGAAAGAAGGGTGGAAGG - Intergenic
904432514 1:30473709-30473731 CAGAGGCAAAGGAGGCTTGAGGG - Intergenic
906520563 1:46464613-46464635 TGGTGGCAAGGGAGGGAGAAGGG - Intergenic
906561474 1:46761150-46761172 CAGTATCAAGGGAGGGTGGAGGG + Intronic
906814765 1:48867393-48867415 TAGAGACAAAGGGGGATGGATGG + Intronic
907077989 1:51595333-51595355 TAGAGGGAAGGGAGGATGGAGGG - Intronic
907124387 1:52036497-52036519 CAGAGGCAGAAGAGGGTGGAAGG + Intronic
907574104 1:55510326-55510348 TGGTGTCAAAGGAGGGTGCTAGG + Intergenic
908075725 1:60515546-60515568 TATTGTTAAAGGAGAGTGGAAGG - Intergenic
908504189 1:64778825-64778847 AAGAGGAAAAGGAGCGTGGATGG - Intronic
909776843 1:79493009-79493031 AAGGAGCAATGGAGGGTGGAAGG + Intergenic
910803559 1:91167962-91167984 TAGTGGCACAGGACTGTGGTAGG + Intergenic
911337618 1:96599687-96599709 TAGAGGCTGAGGAGGGAGGATGG + Intergenic
911908252 1:103596591-103596613 TAGAGGCTGAGAAGGGTGGATGG + Intergenic
911910621 1:103629634-103629656 TAGAGGCTGAGAAGGGTGGATGG + Intergenic
911914666 1:103682875-103682897 TAGAGGCTGAGAAGGGTGGATGG - Intronic
911918036 1:103723759-103723781 TAGAGGCTGAGAAGGGTGGATGG + Intronic
911985118 1:104613169-104613191 TTGTGGCAATAGAGAGTGGAGGG - Intergenic
912331944 1:108828010-108828032 GGGAGGCCAAGGAGGGTGGATGG + Intronic
913088275 1:115458828-115458850 TATTGGAGCAGGAGGGTGGATGG - Intergenic
913613315 1:120530029-120530051 TAGGGGCAAAGGTGGGTAGGAGG + Intergenic
914334084 1:146699423-146699445 GATTGGAAGAGGAGGGTGGAAGG + Intergenic
914577871 1:148992218-148992240 TAGGGGCAAAGGTGGGTAGGAGG - Intronic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
915042089 1:152977114-152977136 GATTGGCAGAGGAGGATGGAAGG + Intergenic
915425263 1:155820739-155820761 TAGGGGCCAAGGTGGGAGGATGG + Intronic
915661051 1:157405315-157405337 GAGTGGTAAAGATGGGTGGAAGG - Intergenic
915944667 1:160141147-160141169 AAGTGGCTTAGGAAGGTGGAAGG - Intronic
915993142 1:160537800-160537822 TAGTTGCAAAGGAGATTGTATGG - Intergenic
916126885 1:161579643-161579665 TAGAGGAAAAGCAGGCTGGAGGG - Intergenic
916136804 1:161661447-161661469 TAGAGGAAAAGCAGGCTGGAGGG - Intronic
916499269 1:165373097-165373119 TATTGTCAAAGGATCGTGGATGG - Intergenic
916591321 1:166193613-166193635 TAGTTGCAGAGCAGGGTGGGTGG + Intergenic
916845065 1:168642382-168642404 TATTGGCAAAGGAGGGAACAGGG - Intergenic
916942756 1:169693311-169693333 TACTGGAAAAGGAGGGTGCCTGG + Intronic
917114762 1:171591763-171591785 TGGTGGCTATGGAGGGTGCAGGG - Exonic
918255597 1:182743577-182743599 TAGTGGGAAATGATGCTGGAAGG - Intergenic
918462866 1:184794385-184794407 AAGCGGAAATGGAGGGTGGAAGG - Exonic
919554642 1:199035452-199035474 TAGTAGCAAAGGAGTGAGGAAGG + Intergenic
919697656 1:200595014-200595036 TAGTGGCAGATGAGGGAGGTTGG - Intronic
919774814 1:201187557-201187579 CCGTGGCCAAGGAGGATGGAAGG + Intergenic
919782492 1:201229741-201229763 TAGTGGCAAAGGGAGGCTGAGGG - Intergenic
921893999 1:220380079-220380101 TAGTGATACAGGAGGGTGGCAGG - Intergenic
922433606 1:225581431-225581453 GAGTGGGAGTGGAGGGTGGAGGG + Intronic
922436048 1:225607726-225607748 TTGGGGAAAAGGAGGGTGGTGGG - Intronic
922598824 1:226834497-226834519 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
922640085 1:227221531-227221553 TAGTGGGAAGGGAGGGTGGGTGG - Intronic
923610643 1:235489787-235489809 TGGTGGCAAGGAAGGATGGAAGG - Intronic
923796159 1:237157736-237157758 TAGTGGGAAGGGACGGTGGGAGG + Intronic
1063288463 10:4715193-4715215 TGGTGAGAAAGGAGAGTGGAGGG - Intergenic
1064714935 10:18167040-18167062 GAGTAGCAAGGGAGGCTGGAGGG - Intronic
1065411707 10:25436547-25436569 GAGTGGCCAGAGAGGGTGGAAGG + Intronic
1066518589 10:36191337-36191359 GAGTCCCAAAGGAGGATGGAAGG + Intergenic
1067410084 10:46056420-46056442 TGGAGGCAAAGGCGGGTGGATGG + Intergenic
1067411012 10:46064638-46064660 AAGTGGGAGAGTAGGGTGGAAGG - Intergenic
1067477359 10:46575854-46575876 CAGTGGAGAAGGAGGGTGGGAGG + Intergenic
1067617381 10:47765930-47765952 CAGTGGAGAAGGAGGGTGGGAGG - Intergenic
1069506001 10:68998635-68998657 TAGTGGCAAAAGATGGTAGAAGG + Intronic
1069652897 10:70063981-70064003 TAGTAGTAAAGGAGGGAGAAAGG - Intronic
1070467919 10:76743269-76743291 AAGTGGGAAAGCTGGGTGGATGG + Intergenic
1070531316 10:77339748-77339770 TAGCTGCAAGGGAGGCTGGAAGG - Intronic
1071187087 10:83058393-83058415 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1071565985 10:86671489-86671511 GACTGGGAAAGGAGGGTGGCGGG + Intronic
1071676656 10:87661170-87661192 AAGTGGGGAAGGAGTGTGGAGGG + Intronic
1073196893 10:101698817-101698839 CAGAGGCCAAGGCGGGTGGATGG - Intergenic
1074505873 10:114069983-114070005 GAGAGGCTAAGGTGGGTGGATGG - Intergenic
1074778401 10:116783300-116783322 CAGTGGCAGAGGAGCCTGGATGG + Intergenic
1075651351 10:124129796-124129818 CAGAGGCAAAGGAGGCTGGAGGG + Intergenic
1076494912 10:130890753-130890775 AAGTGGGAAAGGAGGGGGAAGGG + Intergenic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077346026 11:2054427-2054449 GAGAGGCCAAGGCGGGTGGATGG - Intergenic
1077347503 11:2070666-2070688 TAGTGGGACAGGATGGTGGAGGG - Intergenic
1079129236 11:17737876-17737898 AAGTTGCAGAGGAGAGTGGAGGG + Intronic
1079234147 11:18675638-18675660 TAGTGACAGTGGAGTGTGGAGGG - Intergenic
1080840135 11:35976358-35976380 TGGTGGGAAAGGAGGGTAGGAGG + Intronic
1081017372 11:37899767-37899789 GAGTGGTAAAGGAGGAGGGAGGG - Intergenic
1082099379 11:48159414-48159436 TAGGGGCAAAGGGAGCTGGATGG + Intronic
1082631008 11:55541952-55541974 GGGAGGCAAAGGAGGGAGGATGG + Intergenic
1083610783 11:64003184-64003206 TAACGGTAGAGGAGGGTGGAGGG - Intronic
1083923346 11:65792041-65792063 GAGGGGCAGAGGAGGCTGGATGG - Intronic
1084232154 11:67760945-67760967 AAGGAGGAAAGGAGGGTGGAAGG - Intergenic
1084677928 11:70647391-70647413 AGGTGGCACAGGAGGGTGGTTGG + Intronic
1084882820 11:72184033-72184055 GGGTGGCAAAGGTGGGAGGATGG - Intergenic
1086438414 11:86803921-86803943 TGGAGGCAAAGGAGGGGGAAAGG - Intronic
1087714915 11:101596589-101596611 TAGTGGGCATGGAGGGGGGATGG + Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088506458 11:110532326-110532348 GAGAGGCCAAGGTGGGTGGATGG - Intergenic
1088692159 11:112337406-112337428 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1089066022 11:115662616-115662638 GAGAGGCCAAGGTGGGTGGATGG - Intergenic
1089096229 11:115922302-115922324 TAGGGGCAAAGGAGGTTGAAGGG - Intergenic
1089678680 11:120107501-120107523 AAGAGGCAAAGGAGTGGGGAGGG - Intergenic
1089699072 11:120233677-120233699 TGAGGGCAGAGGAGGGTGGAGGG - Intergenic
1090382351 11:126336342-126336364 GAGTGGCAAAGGTGGTGGGATGG - Intronic
1090719488 11:129458812-129458834 GAGTGGAAAAGGAGGCAGGAAGG - Intergenic
1090892030 11:130932304-130932326 TAGAAGCAAAGAAGGGTGGTGGG + Intergenic
1091818939 12:3459932-3459954 TAATGGCATAGGAGGGTCGGAGG - Intronic
1091919660 12:4294154-4294176 TGGAGGCAGAGGAGGGTGCAGGG + Intronic
1092049806 12:5460345-5460367 TGGTGGCAGAGGAGGGAGGAGGG - Intronic
1092283355 12:7114017-7114039 TACTGGCAGAGTAGGGAGGATGG - Intergenic
1092474345 12:8806196-8806218 AAGGAGGAAAGGAGGGTGGAAGG - Intergenic
1093322131 12:17724737-17724759 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1094278543 12:28708060-28708082 TTGTGTCAATGGAGCGTGGATGG - Intergenic
1095491405 12:42737877-42737899 TACTGGCAACTGAGGCTGGAAGG + Intergenic
1096213364 12:49783938-49783960 AAATGGCAAAGGAGGCTGCAGGG - Intergenic
1096259383 12:50081434-50081456 TGGTGGCAGAGGCGGGTGGGCGG - Intronic
1096584624 12:52611816-52611838 TAGGGAAAAAGGAGGATGGATGG - Intronic
1097542345 12:60956446-60956468 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1097899425 12:64858185-64858207 TGGTGGGAATGGAGGGTGGGCGG - Intronic
1098280083 12:68853815-68853837 GAGAGGGAAAGGAGGGAGGAAGG + Exonic
1098284569 12:68894445-68894467 TAGTGGGAAATTCGGGTGGAGGG - Intronic
1101094085 12:101318075-101318097 TGGTGGGGAAGGTGGGTGGAAGG - Intronic
1101201043 12:102436602-102436624 TTGTGGCAAAGGAGGGTGGAAGG + Intronic
1101869616 12:108554134-108554156 GAGTGGCATAGGAGGGGGGCCGG - Intronic
1103190351 12:118996022-118996044 TAGATGCAAAGGTGGATGGATGG - Intronic
1103254283 12:119527433-119527455 TGCTGGAAAAGTAGGGTGGAAGG + Intronic
1103589403 12:121980585-121980607 GGGAGGCTAAGGAGGGTGGATGG - Intronic
1103842865 12:123879471-123879493 ATGGGGCAAAGGAGGGTGGGTGG + Intronic
1104071934 12:125353406-125353428 TAGAGGAAAAGGAGGGCAGATGG + Intronic
1104500025 12:129276131-129276153 TAGGGGTTAGGGAGGGTGGAGGG - Intronic
1104937500 12:132374390-132374412 AAGTGTGAAAGGAGGCTGGAGGG - Intergenic
1105300428 13:19129237-19129259 TGGAGGCCAAGGCGGGTGGATGG + Intergenic
1106005222 13:25763567-25763589 TAGTGGGAAAGGATAGTGGCAGG - Intronic
1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG + Intergenic
1106464363 13:29999639-29999661 TATTGGGAAAGGAGGAGGGAAGG - Intergenic
1106601209 13:31188607-31188629 TAGTGGCAAAACAGAGAGGAGGG - Intergenic
1107804980 13:44145267-44145289 TAGTGGGAAAGGAGTGAGGATGG + Intronic
1108441321 13:50456256-50456278 CAGTGGACAAGGAGGCTGGAGGG - Intronic
1109102885 13:58208768-58208790 CAATGGCAAAGAAGGGTGGTTGG + Intergenic
1110473356 13:75885538-75885560 CAGAGGCCAAGGAGGGTGGACGG - Intergenic
1111925681 13:94461041-94461063 TAGTGTCAAAGGTGGGGGAAGGG + Intronic
1112780001 13:102889989-102890011 TAGTGGTAGAGGTGGGTGGTAGG + Intergenic
1114517606 14:23309820-23309842 GAGTGGGAGAGGAGGGTGGCAGG - Exonic
1115147219 14:30239566-30239588 TAGGGGGAAAGGAGGAAGGAGGG - Intergenic
1115923516 14:38405339-38405361 TAGAGGCGAAGGAGTGAGGAGGG + Intergenic
1116013318 14:39376745-39376767 AAGGGGCAAAGCAGGCTGGAGGG + Intronic
1116458363 14:45144306-45144328 TAGTGGGCGAGGGGGGTGGAGGG - Intronic
1116945884 14:50834812-50834834 TGGGGGCTAAGGTGGGTGGATGG + Intergenic
1117207646 14:53460463-53460485 TCGTGGCATGGGAGGGTAGAGGG + Intergenic
1117483937 14:56174863-56174885 TAGTGGGAAAGGAGGGTAAAAGG - Intronic
1118224469 14:63886001-63886023 TACTGGCAAAAGAGGGAGGGAGG - Intronic
1118594650 14:67426276-67426298 TAGTTGCTGAGGAGGGTAGAGGG + Intergenic
1118638582 14:67771121-67771143 TTGAGACAGAGGAGGGTGGAAGG - Intronic
1119432783 14:74579229-74579251 TAGGGGCAAAGGTGCGGGGAAGG - Intronic
1119535564 14:75400168-75400190 TAGAGGCAAAAGAAGGGGGAAGG - Intergenic
1119935150 14:78585506-78585528 TAGGGACAAGGGAGGGTGGAGGG + Intronic
1120203387 14:81562532-81562554 TGGGGGCAAAGTAGGCTGGAAGG + Intergenic
1120251541 14:82065542-82065564 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1120994562 14:90406912-90406934 TAGTTTCAAAGGGGGCTGGAGGG + Exonic
1121321638 14:92995029-92995051 TACAAGCCAAGGAGGGTGGAAGG + Intronic
1122507479 14:102240870-102240892 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1122600697 14:102920273-102920295 TAGTGGGAGTGGATGGTGGATGG - Intergenic
1123436622 15:20259255-20259277 TAGAGGCCAAGGCAGGTGGATGG + Intergenic
1124954510 15:34351306-34351328 TAGAGGCTAAGGTGGGAGGATGG + Intronic
1125294261 15:38185198-38185220 TAGAGGAAATGGAGGGAGGAGGG + Intergenic
1126436902 15:48645864-48645886 GAGTGGAAAGGGAGGATGGATGG - Intergenic
1126978669 15:54216143-54216165 TAGAGGCAAAGGAGGGGTAAAGG + Intronic
1128383297 15:67129086-67129108 TAGGGGGACAGGAGTGTGGAAGG - Intronic
1129028940 15:72604795-72604817 CAGTGGCACAGGAGGGTCCAGGG + Intergenic
1129410476 15:75348002-75348024 AAGTGGCAAAGCAGGGAGGGCGG + Intronic
1129746950 15:78028845-78028867 ATGTGGCAAAGGAGGGGGAAGGG + Intronic
1131081379 15:89539130-89539152 GAGTGGGAAAGAAGGATGGAGGG + Intergenic
1131304903 15:91233796-91233818 TAGAAGCAAAGAGGGGTGGAGGG - Intronic
1131447586 15:92512766-92512788 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1131849870 15:96527360-96527382 GAGTGGCAGAGCAGGGTGAAGGG - Intergenic
1132142227 15:99405580-99405602 TAGTAGGAAAGGAGAATGGAGGG + Intergenic
1132262864 15:100441534-100441556 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1132772663 16:1572980-1573002 GAGTGGCAAGGCAGGCTGGAAGG + Intronic
1132782459 16:1635280-1635302 TGGTGGCAAGCGAGCGTGGAAGG + Intronic
1132888529 16:2193390-2193412 TAATGGCAAGGGATGGTGGTAGG - Intronic
1134501898 16:14775872-14775894 CAGAGGCCAAGGAGGGTGGATGG - Intronic
1134578663 16:15353022-15353044 CAGAGGCCAAGGAGGGTGGATGG + Intergenic
1134723925 16:16404523-16404545 CAGAGGCCAAGGAGGGTGGATGG - Intergenic
1134943505 16:18307347-18307369 CAGAGGCCAAGGAGGGTGGATGG + Intergenic
1135024642 16:18989625-18989647 TAGTGGCGAAGGAGGCAGGTAGG + Intronic
1135122729 16:19780408-19780430 GAGAGGCCAAGGAGGGAGGATGG - Intronic
1135315431 16:21440932-21440954 TAGTGGCGAAGGAGGCAGGTAGG - Intronic
1135368357 16:21873200-21873222 TAGTGGCGAAGGAGGCAGGTAGG - Intronic
1135443460 16:22497949-22497971 TAGTGGCGAAGGAGGCAGGTAGG + Intronic
1135449259 16:22543414-22543436 TAGTGGCGAAGGAGGCAGGTAGG + Intergenic
1136312101 16:29419591-29419613 TAGTGGCGAAGGAGGCAGGTAGG - Intergenic
1136325540 16:29521388-29521410 TAGTGGCGAAGGAGGCAGGTAGG - Intergenic
1136440229 16:30261370-30261392 TAGTGGCGAAGGAGGCAGGTAGG - Intergenic
1136568295 16:31082659-31082681 TAGTGGCCACCGAGGGTGGGTGG + Intronic
1137989742 16:53141978-53142000 GAGTGGCAAATAAGAGTGGAGGG + Intronic
1138637423 16:58352191-58352213 GAGTGGAGAAGGAGGTTGGATGG - Intronic
1138976899 16:62218639-62218661 AAGTGGAAAATGAGGGAGGAAGG - Intergenic
1139221993 16:65192902-65192924 TAGTGGCTGAGAAGGGTGGGTGG - Intergenic
1139999534 16:71011826-71011848 GATTGGAAGAGGAGGGTGGAAGG - Intronic
1140206433 16:72937379-72937401 GAGTGGCAAAGGCGGCTGAAAGG + Intronic
1140317809 16:73916012-73916034 GAGAGGCAGAGGAGGGAGGAGGG - Intergenic
1140662413 16:77199970-77199992 GACAGGCAAAGGAGGGTGGAGGG + Exonic
1140767212 16:78171382-78171404 TAGTGTCAAAGGAGATTGCATGG - Intronic
1141537645 16:84693674-84693696 TATGGGCAAAGGAGTGAGGAGGG + Intergenic
1142707507 17:1705585-1705607 CAGAGGCAAAGAAGGATGGAGGG - Exonic
1143562701 17:7705139-7705161 GAGGGGCAGAGGATGGTGGAGGG - Intergenic
1143585216 17:7847455-7847477 GAGTGACAACTGAGGGTGGAGGG + Intronic
1143709424 17:8724120-8724142 TAGAGGCCAAGGTGGGTGGATGG - Intergenic
1144257752 17:13486365-13486387 TAGGGGCAAAGGACCCTGGAAGG + Intergenic
1144504357 17:15817460-15817482 AAGATGCAAAGGAGGGTGGATGG - Intergenic
1144634114 17:16893128-16893150 AAGATGCAAAGGAGGGTGGATGG - Intergenic
1145168211 17:20632969-20632991 AAGATGCAAAGGAGGGTGGATGG - Intergenic
1146164301 17:30575938-30575960 AAGATGCAAAGGAGGGTGGATGG - Intergenic
1146705403 17:34997383-34997405 TCGGGGCAAAGCAGGGTGCAGGG + Intronic
1147473331 17:40685178-40685200 TATTGCCAAATGAGAGTGGAAGG - Intergenic
1148018650 17:44539632-44539654 AAGTGGGAAAGGAGGAGGGAAGG + Intergenic
1148242076 17:46006421-46006443 CAGAGGCTGAGGAGGGTGGAGGG + Intronic
1148290893 17:46448210-46448232 AAGAAGCAAAGGATGGTGGATGG + Intergenic
1148313083 17:46665915-46665937 AAGAAGCAAAGGATGGTGGATGG + Intronic
1148518387 17:48244286-48244308 TAGGGGCAAAGGAGGAAGGAAGG - Intronic
1148583764 17:48762186-48762208 TAATGGGAAAGGAGGGTTGTGGG - Intergenic
1149328978 17:55561780-55561802 GAGTGGTAAAGGTGGATGGATGG + Intergenic
1150182910 17:63145303-63145325 GAGTGGGAAAGAAGGGTAGAAGG - Intronic
1150233452 17:63573000-63573022 GGGAGGCCAAGGAGGGTGGATGG - Intronic
1150559548 17:66282789-66282811 TGGAGGCTAAAGAGGGTGGAGGG - Intergenic
1151064764 17:71136635-71136657 TAATGGCAAGGGAGGAGGGAGGG + Intergenic
1151143068 17:72013974-72013996 TAGAGGAACTGGAGGGTGGAGGG - Intergenic
1151981735 17:77515292-77515314 CAGTGGCAAAGTAGGGTGGTAGG - Intergenic
1153107075 18:1540282-1540304 TGGTGGTAGAGTAGGGTGGAAGG + Intergenic
1153818695 18:8813473-8813495 TAGTGGCAGAGCAGGGTGGGTGG + Intronic
1156229103 18:35136743-35136765 TGGGGGCAAAGGAGAGAGGAAGG - Intronic
1156360428 18:36379929-36379951 GAGTTGAAAAGGAGGATGGATGG + Intronic
1157523428 18:48361036-48361058 TAGAGGCTAGGGAGGGAGGAAGG + Intronic
1158660118 18:59379472-59379494 TGGAGGCAGAGGAGGCTGGAAGG + Intergenic
1159325792 18:66915400-66915422 TAGTTGGGGAGGAGGGTGGAGGG + Intergenic
1159686983 18:71434769-71434791 TAGTGGTGGAGGTGGGTGGAGGG + Intergenic
1160888722 19:1365643-1365665 CAGTGCCAAGGGAGGGCGGAGGG - Intronic
1160989918 19:1856272-1856294 GAGGGGCACGGGAGGGTGGAGGG + Intronic
1161939086 19:7391465-7391487 TAGTGGGAGAGAAGCGTGGAGGG - Intronic
1164202644 19:23031268-23031290 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1164258613 19:23550495-23550517 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1164441692 19:28284449-28284471 GGGAGGAAAAGGAGGGTGGAGGG + Intergenic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1164441774 19:28284758-28284780 TAGAGGGGAAGGAGGGTGGGAGG + Intergenic
1164441779 19:28284774-28284796 TGGGAGGAAAGGAGGGTGGAAGG + Intergenic
1164441791 19:28284806-28284828 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441798 19:28284822-28284844 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441805 19:28284838-28284860 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441830 19:28284900-28284922 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441866 19:28285021-28285043 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441932 19:28285238-28285260 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441961 19:28285326-28285348 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1165090314 19:33384012-33384034 GAGTGACACAGGAGGATGGAGGG - Intergenic
1166910475 19:46151668-46151690 TGGAGGCCAAGGAAGGTGGATGG + Intronic
1167412830 19:49355262-49355284 TGGGGGCAAAGGGGGATGGATGG - Intronic
1167882308 19:52470258-52470280 TAGAGGCAAAGAAGGGTGGTGGG - Intronic
1167900908 19:52621645-52621667 TAGGAGGAATGGAGGGTGGATGG - Intronic
1167965037 19:53137335-53137357 TAGTGCCAAAGGAGGGAACACGG - Intronic
926155782 2:10453268-10453290 GAGTGGCAAAAGAGGCTGGGAGG - Intergenic
926740215 2:16104304-16104326 TGGAAGGAAAGGAGGGTGGAAGG + Intergenic
927151937 2:20201205-20201227 AAATGGCAAAGGAAGGTGGATGG - Exonic
927894380 2:26772009-26772031 CAGGGGCAAAGGAGAGTTGAAGG - Intronic
928043945 2:27908510-27908532 GAGAGGCCAAGGTGGGTGGATGG - Intronic
928079914 2:28301690-28301712 TGCTGGCAAAGTAGAGTGGATGG - Intronic
928101429 2:28439787-28439809 GTGTGGCAGAGGAGTGTGGAGGG - Intergenic
928456724 2:31429046-31429068 TAGTGGGAAATGAGGCTGGAAGG - Intergenic
930903193 2:56533130-56533152 TAGAAGCAAAGAAGGGTGGTGGG + Intergenic
931909972 2:66888722-66888744 TGGAGGCAAAGGAAGGAGGAAGG + Intergenic
932215928 2:69965957-69965979 TAGGGGCAAAGAAGGGTAGGAGG - Intergenic
933261996 2:80141384-80141406 AAGGTTCAAAGGAGGGTGGAAGG + Intronic
934094289 2:88584859-88584881 TAGTGGCTGAGCACGGTGGAGGG + Intronic
934856343 2:97732682-97732704 AAGTGGCAGAGGGCGGTGGAGGG - Intronic
935073024 2:99712483-99712505 TTGTGCCAAAGGAGTGAGGAAGG - Intronic
936166974 2:110129417-110129439 TAGGGGCAAATGAAGGTTGAAGG - Intronic
936298749 2:111288466-111288488 CAGTGGCAAGGCAGGGCGGAAGG - Intergenic
940088295 2:149886479-149886501 CGGAGGCCAAGGAGGGTGGATGG + Intergenic
940322385 2:152390678-152390700 GAGTGGGAAAGAAGGTTGGATGG - Intronic
942312227 2:174666639-174666661 TAGTGGTCAAGGAATGTGGAGGG - Intronic
942636738 2:178015773-178015795 GAGAGGAAAAGGAGGGTGGAAGG + Intronic
942919381 2:181352676-181352698 TAGTAGGAAGGGAGGGTGGGAGG + Intergenic
944646243 2:201783426-201783448 CCTTGGCCAAGGAGGGTGGAGGG + Intergenic
944687009 2:202126347-202126369 TATAGGCAAATCAGGGTGGAAGG + Intronic
944843660 2:203646985-203647007 TATTGGCACAGGATGGGGGAGGG + Intergenic
945630279 2:212266128-212266150 TAAGGGCAAAGGAAGGGGGAAGG - Intronic
945698091 2:213134327-213134349 TAGTGGGAAAGGAGATTGGAAGG - Intronic
946556199 2:220860405-220860427 AAGTGGCAAAAGAAGGTGGAAGG + Intergenic
946881901 2:224185012-224185034 GTGAGGCAGAGGAGGGTGGATGG - Intergenic
948797754 2:240413322-240413344 AAGTGGCACAGGGGAGTGGACGG + Intergenic
948974720 2:241457276-241457298 AAGGAGCAAAGGAGGGAGGACGG - Intronic
1169071978 20:2738381-2738403 TAGAGAAAAAGGAGGGAGGAGGG - Intronic
1169505724 20:6209214-6209236 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1170358311 20:15517195-15517217 CAGAGGCCAAGGAGGCTGGAGGG - Intronic
1170475876 20:16713969-16713991 GGGTGGGAATGGAGGGTGGAAGG + Intergenic
1170848509 20:19982458-19982480 TGGTGGCTGAGGAGGGTGGAAGG - Intronic
1171879705 20:30609551-30609573 TAGTGGGAAAGGAATATGGATGG + Intergenic
1171986707 20:31665869-31665891 TGGTGGCAATGGCGGCTGGACGG + Exonic
1172113937 20:32562925-32562947 GAGTGGAGAAGGAGGGTGGAGGG + Intronic
1172333011 20:34089052-34089074 TAGTGGCCAACGAGGAAGGAGGG + Exonic
1172460285 20:35112956-35112978 GAGTGGGAAAGGAGGGAGGGAGG + Intergenic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1174387250 20:50194460-50194482 TGGTGACAAAGGAGGGAGCAGGG - Intergenic
1174620953 20:51874266-51874288 TAGTGGCAAATGTGCATGGAGGG - Intergenic
1175886816 20:62296894-62296916 TAGTGTCCAAGGACGGTGAAGGG + Intergenic
1177167854 21:17623178-17623200 GAGAGGCCAAGGTGGGTGGATGG - Intergenic
1181338295 22:22157801-22157823 TAGAGAGAAAGGTGGGTGGAGGG + Intergenic
1181492138 22:23267213-23267235 GACTTGCAAAGGAGGGAGGAGGG + Intronic
1182244545 22:28945450-28945472 GAGAGGCCAAGGAGGGTGGATGG + Intronic
1183207312 22:36428395-36428417 TAGGAGCCAAGGAAGGTGGATGG - Intergenic
1184689957 22:46113026-46113048 TGGAGGCAAATGAGGATGGAAGG + Intronic
1184949900 22:47833873-47833895 TAGGGACAAAGGAGGGATGAAGG + Intergenic
949433111 3:3999694-3999716 GAGTGGGAAAGGTGGGAGGAGGG + Intronic
949455597 3:4235140-4235162 TAGAGACAAAGGAAAGTGGATGG + Intronic
950158826 3:10743753-10743775 CAGTGGCGGGGGAGGGTGGAGGG - Intergenic
950670131 3:14521019-14521041 TGGTGGCTAAGGAGGGGAGAAGG - Intronic
952219789 3:31313533-31313555 TGGGGGTAAAGGAGAGTGGAGGG - Intergenic
953193417 3:40710739-40710761 TAGAGTCTTAGGAGGGTGGATGG - Intergenic
953280383 3:41548658-41548680 TAGTGGGCAGGGAGGGTGGGTGG - Intronic
954915121 3:54142277-54142299 TAGTGGCAAGGGAGGGAGTTTGG - Intronic
955043937 3:55342155-55342177 TAGGGGCCAAGGAGCGTAGACGG + Intergenic
955378493 3:58417805-58417827 TAATCCCAAAGGAGGGTGGGAGG - Intronic
955512484 3:59695370-59695392 TAGGGGAAATGGAGGGTGGAGGG - Intergenic
955530431 3:59867048-59867070 TGGTTGTAAAAGAGGGTGGAGGG - Intronic
956906110 3:73767058-73767080 ACTTGGCGAAGGAGGGTGGAGGG - Intergenic
958552449 3:95634662-95634684 TAGTGGAAAAAGAAGGTAGAAGG - Intergenic
958843633 3:99239080-99239102 TAATGGCTAAGGAGAGTGGGGGG - Intergenic
959462071 3:106639520-106639542 TAGAGGCTAAGAAGGGTAGAGGG - Intergenic
959543854 3:107571123-107571145 AAGGGGGAATGGAGGGTGGAAGG + Intronic
961214113 3:125146619-125146641 TCCTGGCCAAGGATGGTGGAAGG + Intronic
962461913 3:135621903-135621925 TATGTGCAGAGGAGGGTGGAGGG - Intergenic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
964843038 3:161015076-161015098 GAGTAGCAAAGGGGGGTGAATGG + Intronic
964877906 3:161390170-161390192 TAGTGGCAAAGGGGAAAGGATGG + Intergenic
966300746 3:178476869-178476891 TAGAGGAGAAGGAGAGTGGAAGG + Intronic
966398596 3:179525390-179525412 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
968086940 3:195878038-195878060 CAGTGGGAAAGGGTGGTGGAGGG + Intronic
968581198 4:1396181-1396203 TTGTGGCAAGTGTGGGTGGAAGG - Intergenic
969704628 4:8785033-8785055 TTGTGGGAAGGGTGGGTGGAGGG - Intergenic
972578895 4:40377716-40377738 GACTGGCATAGGAGGATGGATGG - Intergenic
973750975 4:54021058-54021080 AAGGGGGAATGGAGGGTGGAAGG - Intronic
976443722 4:85106612-85106634 AAGTGGGAAAAGAGGGAGGAAGG - Intergenic
976953145 4:90858842-90858864 TACTGCCAAAGAAGGGAGGAAGG + Intronic
977086847 4:92610545-92610567 AAGTGGAAAAGGAGGGGGAAGGG - Intronic
977825568 4:101527354-101527376 GTGTGGCAAAGGAGGGGGTAGGG + Intronic
977847373 4:101781612-101781634 TAGAAGCAAAGAAGGGTGGTGGG + Intronic
978003204 4:103582461-103582483 TAGTGCTAAAGGAGAGAGGAAGG - Intergenic
978303379 4:107294905-107294927 AAGGGGTAATGGAGGGTGGAAGG + Intergenic
979809921 4:125024542-125024564 TAGTGGCAAAGTAGGAAGGTGGG - Intergenic
980208699 4:129756406-129756428 TAGTGGCAGGGGAAGGAGGAGGG - Intergenic
980532190 4:134070509-134070531 TGGTGGCATAGTGGGGTGGAGGG + Intergenic
980582890 4:134775496-134775518 TAGAAGCAAAGAAGGGTGGTAGG + Intergenic
981482867 4:145256000-145256022 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG + Intergenic
985054621 4:186025590-186025612 GAGTGTGAGAGGAGGGTGGATGG + Intergenic
985055211 4:186030201-186030223 TACTGGCAAAGGAAGAGGGAAGG - Intergenic
985787829 5:1909029-1909051 CAGTGGCACAGCAGGGTTGATGG + Intergenic
985933479 5:3077713-3077735 GAGTGGGAAAGGAGGGAGGCTGG + Intergenic
986141495 5:5034597-5034619 TGGAGGCCAAGGTGGGTGGACGG + Intergenic
987304808 5:16627462-16627484 GAGCGGCAAAGGGAGGTGGAAGG - Intergenic
987346996 5:16987841-16987863 TTATGGCTAAGGAGGGGGGAAGG - Intergenic
988424676 5:31049743-31049765 TAGTAGGAAAGGTGGGAGGAAGG - Intergenic
989683226 5:44054272-44054294 TAGTGGAAAAGGTAGATGGAGGG + Intergenic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
994807329 5:104466340-104466362 TAGTGGAAAAGGATGATGAAAGG + Intergenic
994989399 5:106979641-106979663 TAGGAGGAATGGAGGGTGGAAGG - Intergenic
996201992 5:120686558-120686580 TAGTGGGAAAGGAGGGAGATGGG - Exonic
997852738 5:137347101-137347123 TTGGTGCAAGGGAGGGTGGAGGG - Intronic
998985921 5:147756639-147756661 GAGAAGAAAAGGAGGGTGGATGG + Intronic
999090510 5:148931949-148931971 TAGTGGCAGAATAGGGAGGAAGG - Intronic
999210215 5:149881812-149881834 GGGAGGCCAAGGAGGGTGGATGG + Intronic
999420950 5:151442639-151442661 TAGTAGCTGAGCAGGGTGGAAGG - Intronic
999970838 5:156860771-156860793 TAGTGGCAACTGATGGTGGCTGG - Intergenic
1001331603 5:170766464-170766486 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1003469733 6:6418051-6418073 TAGTGGGAGTGGTGGGTGGAGGG - Intergenic
1004225613 6:13781879-13781901 GAGAGGCCAAGGTGGGTGGATGG - Intergenic
1004519838 6:16351505-16351527 AAGAGGCAGAGGTGGGTGGATGG - Intronic
1004697501 6:18047410-18047432 CAATGGGAAAGGAGGCTGGAGGG - Intergenic
1005014806 6:21365943-21365965 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1006054495 6:31373354-31373376 TGGTGGCAGGGGAGAGTGGAAGG + Intergenic
1006775868 6:36592120-36592142 GGGAGGCAGAGGAGGGTGGATGG + Intergenic
1007227514 6:40325398-40325420 GAGTTGCAGAGGAGGGTGGGTGG + Intergenic
1007259544 6:40554068-40554090 TGGTGGCAATGGAGGGTCGTAGG - Intronic
1008410889 6:51178255-51178277 AAGAAGCAAAGGAGGGTGGAAGG - Intergenic
1009006287 6:57792651-57792673 GAGTGGAAAAGAAGGGAGGATGG + Intergenic
1010951190 6:82039011-82039033 GGGTGACAAAGGAGGCTGGAGGG + Intergenic
1012363280 6:98409207-98409229 TAGAAGCAAAGCGGGGTGGAAGG + Intergenic
1012999519 6:106008493-106008515 TTGTGGCAAAAGAGTGTGAAAGG - Intergenic
1013461107 6:110376371-110376393 TAGTGGCAGTGGAGAGGGGAAGG + Intergenic
1013808285 6:114017150-114017172 AAGTAGGAATGGAGGGTGGAAGG + Intergenic
1014908041 6:127054558-127054580 AAGTGGCAATGGTGGGTGGGAGG + Intergenic
1015878405 6:137846866-137846888 TCATGGCAGGGGAGGGTGGAGGG + Intergenic
1016752843 6:147650335-147650357 GGGTGGCAAAGGAGGGGGCAAGG + Intronic
1016950257 6:149572903-149572925 GAGAGGCAGAGGAGGGTAGATGG - Intronic
1017686387 6:156917417-156917439 TAGTTGAACAGGAGGGTTGACGG + Intronic
1018243855 6:161803370-161803392 TATTGGCAAAGGAAGCTGCAGGG - Intronic
1018269024 6:162055905-162055927 TAATGGTAAAGGAGGGAGGGAGG - Intronic
1019184052 6:170210609-170210631 TGGTGGGAAAGGAGAGTGAAGGG + Intergenic
1019438579 7:1034766-1034788 AGGAGGAAAAGGAGGGTGGAGGG - Intronic
1019494460 7:1331302-1331324 TGGGGGCAAAGGAGGCTGGCGGG - Intergenic
1021345242 7:19519452-19519474 CAGTAGCAAAGGAAGGTGAAGGG - Intergenic
1022447258 7:30480499-30480521 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1022449577 7:30502750-30502772 TGGTGGCAGGGCAGGGTGGATGG - Intronic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023724082 7:43124230-43124252 TAGAGGCAAAAGAGAGTGAACGG + Intronic
1024404601 7:48963612-48963634 AAGTGGAAAAAGAGGCTGGAGGG - Intergenic
1027135483 7:75621100-75621122 TGGTGGCAGAGGTGGGAGGATGG + Intronic
1027354263 7:77340924-77340946 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1028163783 7:87515009-87515031 TGCTTGCAAAGGAGGGTAGAGGG + Intronic
1029032414 7:97482842-97482864 TAGTGGGAAAAGAAGGTTGAAGG - Intergenic
1029480550 7:100809872-100809894 GGGAGGCCAAGGAGGGTGGATGG + Intronic
1029942262 7:104492876-104492898 GAGTGGCAATGGATGGTGGAAGG - Intronic
1031329787 7:120450450-120450472 GAGTGGAAAAGGAGAGGGGATGG + Intronic
1031999280 7:128254275-128254297 AAGTGGTGAGGGAGGGTGGAAGG + Intronic
1032991894 7:137403068-137403090 GAGGGGCAAACGAGGGGGGAGGG + Intronic
1033225621 7:139559938-139559960 TAGGGGAAAAGGTGGGTGGAGGG + Intergenic
1034213158 7:149382695-149382717 AAGTGGGAAAGGATGTTGGATGG + Intergenic
1035326276 7:158068030-158068052 TATGGGGAAAGGAGGGAGGAAGG + Intronic
1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035690203 8:1554914-1554936 TAGGGGCAAAAGAGGGAGAAAGG + Intronic
1036472491 8:9063909-9063931 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1037164521 8:15810636-15810658 TTGTGGCCAAGGAGGGGGGGCGG + Intergenic
1039386245 8:37138174-37138196 TTGGGGGAAAGGAGGGTGCAGGG + Intergenic
1039436808 8:37565055-37565077 CGGTGGGAAATGAGGGTGGATGG - Intergenic
1041957550 8:63572769-63572791 TAGTGGCACAGAAACGTGGAGGG - Intergenic
1042523020 8:69734248-69734270 TAGTGGCAAAGGAGGGTGGAGGG - Intronic
1042729025 8:71910787-71910809 TAGAGGCAAAAGTGGGAGGAGGG - Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043743740 8:83846592-83846614 TAGTGCCGAAGGAGGGTTAAAGG + Intergenic
1044372814 8:91433259-91433281 GGGTGGCAAAAGAGGGAGGAGGG + Intergenic
1044512382 8:93097358-93097380 CAGTGGCAAAGGAGGGAGAAAGG + Intergenic
1046340698 8:112851194-112851216 TCTTGGCAAATGAAGGTGGAAGG + Intronic
1049141568 8:140959835-140959857 TGTTGGAAAAGGAGGGTGGTGGG - Intronic
1051853425 9:21535605-21535627 GAGGGAGAAAGGAGGGTGGAGGG + Intergenic
1053141053 9:35682950-35682972 AAGCAGCAAAGGAGGGTGGAAGG + Intronic
1053430849 9:38040884-38040906 GAGTGGCAAGGGAGGGTGCGGGG + Intronic
1054848239 9:69820108-69820130 TGGTGGCAATGGATGATGGACGG + Intergenic
1055652419 9:78419335-78419357 AAGTGGCAAAGGAGGATGGATGG + Intergenic
1056287696 9:85107977-85107999 TGGTGACACAGGAGGGAGGATGG + Intergenic
1056391725 9:86147034-86147056 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1056840796 9:89996662-89996684 GAGTGGGATGGGAGGGTGGAGGG + Intergenic
1057267642 9:93629805-93629827 TACTAGGAAAGCAGGGTGGAGGG - Intronic
1057759368 9:97860239-97860261 TAGGGGCTAAGGAGTGGGGATGG + Intergenic
1057948635 9:99352066-99352088 GAGTGGCACAGGCGGGTGCATGG + Intergenic
1059635933 9:116170709-116170731 TAGCAGAAAAGAAGGGTGGATGG - Intronic
1059779487 9:117511235-117511257 TAGTGGCAAAAGCAGGTGAATGG - Intergenic
1060467724 9:123922171-123922193 GGGAGGCCAAGGAGGGTGGATGG - Intronic
1061203756 9:129151518-129151540 TAGTTGCAAAGGAGGGCGGAAGG + Intergenic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1061393701 9:130331936-130331958 AAGGGGCAGAGGAGGGTGGTGGG - Intronic
1061498375 9:130988868-130988890 AAGTGGCAATGGAGAGAGGATGG + Intergenic
1061509490 9:131051821-131051843 TACTGGGAAAGGAGGAGGGAGGG + Intronic
1062089718 9:134669129-134669151 TAGGTGGAAGGGAGGGTGGATGG - Intronic
1062454452 9:136629103-136629125 TGGGGGCCAAGGAGGGTGGGCGG - Intergenic
1185511569 X:668097-668119 GAGTGGGAAAGGAGAGGGGAGGG - Intergenic
1185963491 X:4573212-4573234 AAGAAGGAAAGGAGGGTGGAAGG + Intergenic
1186169604 X:6862813-6862835 AATTTGCAAAGGATGGTGGATGG + Intergenic
1186216020 X:7302134-7302156 TTGTTTCAAAGGAGGGTGTATGG + Intronic
1187492028 X:19761098-19761120 GAGTGGAACAGGAGGTTGGAAGG + Intronic
1188016494 X:25112744-25112766 TAGTGGCTAAGATGGGAGGATGG - Intergenic
1188366562 X:29322926-29322948 TATTGGCTAAGGAGAGGGGAAGG - Intronic
1188425832 X:30045667-30045689 GGGAGGCAAAGGCGGGTGGATGG - Intergenic
1188430873 X:30104600-30104622 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1188482417 X:30649223-30649245 TGGAGGCTGAGGAGGGTGGATGG + Intergenic
1189157533 X:38773844-38773866 GAGGGGGAAAGCAGGGTGGAGGG + Intergenic
1189485779 X:41430646-41430668 TGGTGGGAATGGAGGGTGGGGGG - Intergenic
1189593709 X:42542540-42542562 AAGAGGCAAAAGAGGCTGGAAGG + Intergenic
1190634211 X:52418497-52418519 GAGAGGCAAAGGAGGGAGGGAGG + Intergenic
1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG + Intergenic
1191805962 X:65134117-65134139 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1193445524 X:81597087-81597109 TAGTGGGAGAGCAGGTTGGAAGG + Intergenic
1195017104 X:100790900-100790922 AAGAGGGAATGGAGGGTGGAAGG + Intergenic
1195345891 X:103950893-103950915 TAGTGGGAAAGGAGAGTGGCTGG + Intronic
1195885073 X:109629205-109629227 TCGTGGAAAATGGGGGTGGAGGG - Intronic
1196885800 X:120244515-120244537 CAGAGGCGAAAGAGGGTGGAGGG + Intergenic
1196942693 X:120793006-120793028 GAGAGGCCAAGGCGGGTGGATGG - Intergenic
1197470811 X:126864352-126864374 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1198169726 X:134093818-134093840 TAGAAGCAAAGAAGGGTGGTGGG - Intergenic
1198416660 X:136427029-136427051 TAGTTGCTAATGAGGGAGGAAGG + Intergenic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic
1200136786 X:153879132-153879154 TAAGGGCAAAGGAGCGGGGAGGG + Intronic
1200695814 Y:6358321-6358343 AAGAGGCTAAGGTGGGTGGATGG - Intergenic
1201039463 Y:9816385-9816407 AAGAGGCTAAGGTGGGTGGATGG + Intergenic
1201559964 Y:15305395-15305417 TATTTGCAAAGGGTGGTGGATGG + Intergenic