ID: 1042523136

View in Genome Browser
Species Human (GRCh38)
Location 8:69735595-69735617
Sequence ACTTATAAGTAGGAGCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042523134_1042523136 -5 Left 1042523134 8:69735577-69735599 CCAAACTCGCATGTTCTCACTTA 0: 1
1: 3
2: 26
3: 133
4: 565
Right 1042523136 8:69735595-69735617 ACTTATAAGTAGGAGCTGAATGG No data
1042523133_1042523136 24 Left 1042523133 8:69735548-69735570 CCTCAGCAAACTAACACAGGAAC 0: 1519
1: 2525
2: 3174
3: 3638
4: 3909
Right 1042523136 8:69735595-69735617 ACTTATAAGTAGGAGCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042523136 Original CRISPR ACTTATAAGTAGGAGCTGAA TGG Intronic
No off target data available for this crispr