ID: 1042523416

View in Genome Browser
Species Human (GRCh38)
Location 8:69738832-69738854
Sequence TTTCTTGGAGGCAGCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042523416_1042523419 6 Left 1042523416 8:69738832-69738854 CCTGCTGAGCTGCCTCCAAGAAA 0: 1
1: 0
2: 2
3: 25
4: 185
Right 1042523419 8:69738861-69738883 AAAGCCTCACCCTTGAGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042523416 Original CRISPR TTTCTTGGAGGCAGCTCAGC AGG (reversed) Intronic
901466503 1:9424912-9424934 TTTTTTTGAGGCATCTCACCAGG - Intergenic
903669389 1:25026501-25026523 TTTCCTGGGGGCAGCTTGGCTGG - Intergenic
903886233 1:26542640-26542662 CTTCTTCGGGGCAGCTGAGCAGG + Intronic
904679170 1:32216813-32216835 CTTCCTGGAGGCAGCAGAGCTGG + Exonic
905342971 1:37291969-37291991 CATCTAGGAGGCAGCTGAGCTGG + Intergenic
910257004 1:85259002-85259024 TGTCTTGGAGGCAGCACCGCAGG + Intronic
910373475 1:86543493-86543515 TTTCTTGGAGCCACCAAAGCTGG + Intergenic
910637301 1:89423155-89423177 TTTGTAGGAGGCAGGTCAGCAGG - Intergenic
911108247 1:94155231-94155253 ATTTTTGGATGCAGCCCAGCTGG + Intronic
912378951 1:109236165-109236187 TCTCTGTGTGGCAGCTCAGCTGG - Intronic
912738740 1:112174100-112174122 TTGCTTGGAAACAGCTCAGGAGG - Intergenic
921286684 1:213615729-213615751 TGTCTTAGCAGCAGCTCAGCTGG - Intergenic
921923536 1:220693028-220693050 TTTCTTGGAGCCACCTGAGAGGG + Intronic
922738236 1:228001202-228001224 CCTCCTGGAGGCAGCACAGCAGG - Intergenic
1062837568 10:646084-646106 TTTCCTGGAGGCCCCTCACCTGG - Intronic
1063159198 10:3407512-3407534 TTACTTGGAGGTACCCCAGCTGG - Intergenic
1063277903 10:4591390-4591412 TTTCTTGGAAGAAGCACAGGAGG - Intergenic
1064076646 10:12274183-12274205 GTCCTTGGCTGCAGCTCAGCTGG - Intergenic
1064460255 10:15528234-15528256 TCTCTTGAAGGGAGCCCAGCAGG - Intronic
1066021109 10:31303179-31303201 TTTCATGGAGACAACTAAGCTGG - Intergenic
1066412958 10:35191786-35191808 CTTCAGGGAGGGAGCTCAGCAGG - Intronic
1071914846 10:90282031-90282053 TTTCTTGTAGACAGCTAAGCTGG + Intergenic
1072539704 10:96389163-96389185 TTTATTGGAGGAAGATCGGCTGG - Intronic
1072543724 10:96418041-96418063 TCTCTAGGAGGGAGATCAGCAGG - Intronic
1074080263 10:110162965-110162987 GTTCTTGCATGCAGCTCAGTGGG + Intergenic
1075310160 10:121407132-121407154 TTTATTGGAAGCATCTCAGCTGG - Intergenic
1077539138 11:3138459-3138481 TCACTTGGAGGCAGTGCAGCTGG + Intronic
1077599679 11:3565729-3565751 TAGCTAGGAGGCAGCTCAGTTGG + Intergenic
1079343532 11:19632608-19632630 TTCCTTGGAGCAAACTCAGCAGG + Intronic
1080642722 11:34167080-34167102 TTTCCTTGAGGCAACTCAGGTGG + Intronic
1081496518 11:43616691-43616713 TTTTTTGGATGCAGATCACCTGG - Intronic
1083784776 11:64937858-64937880 TTAGTTGAAGGCAGCTCAGGTGG + Intronic
1086748578 11:90461804-90461826 TTTGTTGTAGTCAGCTCTGCTGG + Intergenic
1089462882 11:118662993-118663015 GTTCAAGGAGGCAGCTCAGTTGG + Intronic
1090520367 11:127472907-127472929 CATCTTGGAAGCAGCTGAGCTGG - Intergenic
1099488536 12:83257583-83257605 TTTCTTGAAGGCAGTTGTGCTGG - Intergenic
1100227579 12:92574438-92574460 TTTCTTAGCAGCAGCACAGCTGG - Intergenic
1103884231 12:124188883-124188905 TTTCCTGGAGGGAGCAGAGCGGG + Intronic
1104223354 12:126807558-126807580 TTTCTTGGCAGCTGTTCAGCAGG - Intergenic
1104448261 12:128850184-128850206 CTCCTGGGAGGCAGCCCAGCGGG + Intergenic
1108558568 13:51620715-51620737 TTTCTTTGATGTAGCTGAGCCGG + Intronic
1111597597 13:90431498-90431520 TTTCTTGTAGTCAGATCTGCTGG + Intergenic
1112457575 13:99576264-99576286 TTGCTCCCAGGCAGCTCAGCAGG + Intergenic
1113812712 13:113152110-113152132 TGTCATGGAGCCATCTCAGCAGG + Intergenic
1113994577 14:16055687-16055709 TTTCTTGGAAGCTGCCCAGCGGG - Intergenic
1118636766 14:67755121-67755143 TTTCTTGGAGGTAGATCTTCAGG + Exonic
1118982594 14:70728816-70728838 TGTCTTGGAGGTCACTCAGCAGG - Intronic
1119850949 14:77866499-77866521 TACCTGGGGGGCAGCTCAGCTGG + Intronic
1122798748 14:104219509-104219531 ACTCTTGGTGCCAGCTCAGCAGG - Intergenic
1124625220 15:31303865-31303887 TCTCTTGCAGGCAGCTCTGCAGG - Intergenic
1125343599 15:38697577-38697599 TTCCTTGGTGGCAGCTCTGGGGG - Intronic
1125728120 15:41878481-41878503 TCTCTTGCAGGAAGCTCTGCCGG + Exonic
1127546413 15:59997416-59997438 TTTGTGGGTGGCAACTCAGCGGG + Intergenic
1127572721 15:60260118-60260140 TTTCTTGGAGGGAGCAGAGCTGG - Intergenic
1129104611 15:73297619-73297641 GTTCTGGAAGGCAGCACAGCAGG - Intronic
1129142941 15:73618212-73618234 TTTCTCAGAAACAGCTCAGCTGG - Intronic
1129172940 15:73818864-73818886 TTTCTTGGAAGCAGCTCTCACGG + Intergenic
1130696611 15:86137819-86137841 TTTCTCAGAGGCAGCTCCGGAGG + Intergenic
1131031656 15:89191229-89191251 TTTCCTGGTGGAAGCTCAGCTGG + Intronic
1134147990 16:11782962-11782984 TTTCCTGGAGACTGCTCAGGAGG - Intronic
1134843201 16:17417944-17417966 GTTGTTGGGGGGAGCTCAGCTGG - Intronic
1135410795 16:22232935-22232957 TTCCTTGGAGGGAGGCCAGCGGG - Intronic
1135491777 16:22915629-22915651 TTTGTTGGAGGGAGATCAGAGGG - Exonic
1135634180 16:24060053-24060075 TTTCTGAGAGGCATCTGAGCAGG + Intronic
1136913304 16:34161152-34161174 TTTCTTGGAAGCTGCCCAGCGGG - Intergenic
1140499825 16:75423980-75424002 TTTCTGGGAGACAGCTCACTTGG - Intronic
1140712273 16:77689460-77689482 TTTCTTTTAGGCAGCTGAGGTGG - Intergenic
1141662649 16:85449638-85449660 TTTCCTGAATGCATCTCAGCTGG - Intergenic
1141711532 16:85702264-85702286 GTTTTTGGAGGCTGCTAAGCAGG + Intronic
1141756005 16:85991421-85991443 TGGCTAGGAGGCAGCTGAGCTGG + Intergenic
1142839096 17:2613339-2613361 TTGCTTGGGCGAAGCTCAGCCGG + Intronic
1143213683 17:5208354-5208376 TGTCTTAGAGGCAACCCAGCTGG + Intergenic
1145019163 17:19416307-19416329 TGTCTGGGTGGCAGCTGAGCTGG + Exonic
1145909223 17:28533044-28533066 TTTCTTGGGGGCAGCTGGCCTGG - Intronic
1145996349 17:29106977-29106999 TTCCCTGGAGACAGCTCATCTGG - Intronic
1146367401 17:32239584-32239606 GTTGTTGGAGCCAGCTCTGCAGG - Intronic
1146892164 17:36513292-36513314 TTCCTTGGAGGTAGCACAGAAGG + Intronic
1147795542 17:43039807-43039829 TCTGGTGGAGGCATCTCAGCTGG - Intergenic
1149160038 17:53681917-53681939 CTTCTTGGATGCAGCAAAGCAGG + Intergenic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1154009124 18:10560357-10560379 TTCCTGGGAGGGAGCTTAGCCGG + Intergenic
1155541465 18:26872861-26872883 ACTCTGGGAGGCAACTCAGCAGG + Intergenic
1157436319 18:47672554-47672576 TTTCTTGGGAGCAGCTGAGCAGG + Intergenic
1157517723 18:48322482-48322504 CTTCTGAGAGACAGCTCAGCGGG + Intronic
1159291870 18:66433850-66433872 TTCCTTGGAGGCATCACAGATGG + Intergenic
1161220556 19:3116171-3116193 TGTCTGGTAGGCTGCTCAGCTGG + Intronic
1166950970 19:46427920-46427942 TTTCTTGCAGGCAGCTCTCTGGG + Intergenic
1167660210 19:50791871-50791893 CTTCTCGGAGCCAGCTCAGGCGG - Intronic
1168583616 19:57575731-57575753 TTCCTCAGAGGCAGCTCTGCCGG - Intronic
926012225 2:9417348-9417370 TTTCTTGGTGGCATTTGAGCAGG - Intronic
926163746 2:10505365-10505387 TTGCTGGGAGGCAGGCCAGCAGG + Intergenic
927786093 2:25975987-25976009 TTTCTTGGAGGGTGCTCATGTGG + Intronic
928977956 2:37108414-37108436 TTTCATGGAGACATCTAAGCTGG - Intronic
931922942 2:67040520-67040542 TTTCTTGGAGATAGACCAGCAGG - Intergenic
932563230 2:72890099-72890121 TTTATTGGAGGTAGCTGAACTGG + Intronic
934047725 2:88186221-88186243 TTTCCGGGAGGCTGCTCAGCTGG + Exonic
934160464 2:89244691-89244713 TGTCTGGGGAGCAGCTCAGCAGG - Intergenic
934206814 2:89937747-89937769 TGTCTGGGGAGCAGCTCAGCAGG + Intergenic
934789544 2:97046958-97046980 TGTCTGGGGAGCAGCTCAGCAGG + Intergenic
934790017 2:97051095-97051117 TGTCTGGGGAGCAGCTCAGCAGG + Intergenic
934816451 2:97331444-97331466 TGTCTGGGGAGCAGCTCAGCAGG - Intergenic
934816928 2:97335582-97335604 TGTCTGGGGAGCAGCTCAGCAGG - Intergenic
934820768 2:97372902-97372924 TGTCTGGGGAGCAGCTCAGCAGG + Intergenic
934821245 2:97377040-97377062 TGTCTGGGGAGCAGCTCAGCAGG + Intergenic
935657997 2:105441294-105441316 TCTCTTGGAGGAAGCTGGGCTGG + Intergenic
937494926 2:122408421-122408443 TTTCTCAGAAGCAGCACAGCAGG + Intergenic
938536894 2:132255065-132255087 TTTCTTGGAAGCTGCCCAGCGGG + Intronic
944512925 2:200482303-200482325 GTCCTGGGAGGCTGCTCAGCTGG + Intergenic
945889954 2:215419835-215419857 TTTCTTAGAAGCTGCTCAGCAGG - Intronic
945939773 2:215936535-215936557 TTTCTTTTGGGCAGCTGAGCAGG - Intergenic
947829017 2:233125762-233125784 TTTCTTGGGGGCAGCTCGGGTGG - Exonic
948872762 2:240811982-240812004 TTTCCTGGAGTCATCACAGCCGG - Intronic
1169792110 20:9422095-9422117 ATTCTTGGAGACAGCACTGCCGG - Intronic
1170017022 20:11792805-11792827 TTTCAGGGACACAGCTCAGCAGG - Intergenic
1171767668 20:29299021-29299043 TTTCTTGGAAGCTGCCCAGTGGG + Intergenic
1171865795 20:30486842-30486864 TTTCTTGGAAGCTGCCCAGCGGG + Intergenic
1172062643 20:32196918-32196940 TATTTTGGAGGGAGCTGAGCTGG + Exonic
1172185377 20:33028122-33028144 TCTGTTGGGGGCAGGTCAGCAGG + Intergenic
1172362434 20:34322971-34322993 TTCCTGGAATGCAGCTCAGCAGG - Intergenic
1173111669 20:40196757-40196779 CTAGTTGGAAGCAGCTCAGCAGG + Intergenic
1173600417 20:44291080-44291102 TTTATTGGAGACAGCTCATTTGG - Intergenic
1173646603 20:44637207-44637229 ATCCTTGGAGGCAGCCCATCTGG + Intronic
1174519182 20:51116522-51116544 TTTATTGGAGGCAGATCATGTGG + Intergenic
1175134968 20:56816323-56816345 TTTCTTGGAGGAAGCAGAGGGGG - Intergenic
1177397207 21:20552165-20552187 TTTCTTCAAGGCAGCCCATCTGG - Intergenic
1177499901 21:21940290-21940312 GTTTTTGGAGGCAGAACAGCTGG + Intergenic
1178643719 21:34367103-34367125 TCTCTTGTAGGAAGCCCAGCCGG - Intronic
1179037290 21:37769567-37769589 TTTCTCGGAGGCGTCTCAGTGGG - Intronic
1179226196 21:39455534-39455556 TCCCTGGGAGTCAGCTCAGCAGG + Intronic
1179731358 21:43369514-43369536 TTTCTTGAATGCAGCCCCGCTGG + Intergenic
1180312514 22:11251717-11251739 TTTCTTGGAAGCTGCCCAGCGGG + Intergenic
1180342738 22:11630668-11630690 TTTCTTGGAAGCTGCCCAGCGGG - Intergenic
1180589133 22:16921354-16921376 TGTCTGGGGAGCAGCTCAGCAGG - Intergenic
1180843403 22:18969651-18969673 GTGCTGGGAGTCAGCTCAGCTGG - Intergenic
1181058063 22:20269075-20269097 GTGCTGGGAGTCAGCTCAGCCGG + Intronic
1181384415 22:22533405-22533427 TTACTTGGTGACAGCTGAGCAGG - Intergenic
1181514608 22:23403524-23403546 GTGCTGGGAGTCAGCTCAGCCGG + Intergenic
1181626119 22:24123372-24123394 CTTCCAGGAGGCAGCTCTGCAGG + Intronic
1181756834 22:25029823-25029845 TTTCATGGAGGCAGGGCAGAAGG + Intronic
1182679791 22:32069966-32069988 TTTCTTGGAATCAGCTCTGTGGG + Intronic
1183776213 22:39967933-39967955 TTTCTTGGAGCCAGATGAGCAGG + Intronic
1184405789 22:44299603-44299625 TTTGCTGGGGGCAGCTCAGAGGG - Intronic
950167166 3:10810159-10810181 TTTCCTGGGGGCATCTCAGCTGG + Intergenic
950609242 3:14114720-14114742 TTTCTTAGGGGCAGGTAAGCTGG + Intronic
950638639 3:14333618-14333640 TCTCCTGGAGGCAGCTCGGCTGG + Intergenic
951463703 3:22978673-22978695 TTTCCTGGAGCCACCTCAGTAGG + Intergenic
951547293 3:23839615-23839637 TTTCTTGCAGTCAGGTCTGCTGG + Intronic
952082244 3:29773540-29773562 TTTCTTTAGGGCATCTCAGCGGG - Intronic
954870810 3:53766289-53766311 TTCCCAGGAGCCAGCTCAGCTGG + Intronic
955224344 3:57048846-57048868 TTTCTTGGTGCCAGGTCACCAGG - Intronic
955942084 3:64156252-64156274 TTTCTAGGAGGAAGCTGATCAGG - Intronic
960088164 3:113612676-113612698 TAAGTTGGAGGGAGCTCAGCAGG - Intronic
962811184 3:138960656-138960678 TTTCCTGGAGGCAGCGATGCAGG + Intergenic
962904486 3:139789560-139789582 TTTCTTAGATGAAGCTGAGCAGG + Intergenic
963623396 3:147640825-147640847 TTTCTGGGAGGCTGGTCTGCAGG - Intergenic
965664397 3:171077198-171077220 TTTCTTGGAGGCATCTTTCCTGG + Intronic
968138290 3:196235235-196235257 TTTTTTGGAGGCTGCACAGCTGG - Exonic
969521110 4:7678210-7678232 CTTCCTGGAGGCGGCTGAGCAGG + Intronic
971402676 4:26290909-26290931 TTTCTTAGAGGAAGACCAGCTGG - Intronic
971490746 4:27209712-27209734 CAACTTGGAGGAAGCTCAGCTGG - Intergenic
972396500 4:38663663-38663685 TGTTTTGGAAGCAGCGCAGCGGG + Intergenic
973807385 4:54539434-54539456 CTTCTTGGAGGGACCTCGGCTGG + Intergenic
976367176 4:84245003-84245025 TATTTTGGAGGGAGCTGAGCTGG - Intergenic
978121592 4:105085946-105085968 TTTCTTGGGGGCAGTGTAGCAGG - Intergenic
979652195 4:123148412-123148434 TGACTTGGAAGCAGATCAGCTGG + Intronic
979724773 4:123947704-123947726 TTTCTTGGAGGATGCCCATCTGG + Intergenic
980674300 4:136054846-136054868 TTTCTTGGTTCCAGCTCTGCAGG + Intergenic
983204966 4:164902359-164902381 GTTCCTAGAGGCAGCTCAGCAGG + Intergenic
985953935 5:3247566-3247588 TTCCTTGGAGGCAGGTCCACTGG + Intergenic
986377827 5:7150479-7150501 TGCCTTGGAGGCAGCTTAGATGG + Intergenic
991777591 5:70100120-70100142 TTCCTTGGAGGCAGCTAGGTGGG - Intergenic
991856879 5:70975564-70975586 TTCCTTGGAGGCAGCTAGGTGGG - Intronic
992194915 5:74329613-74329635 TTTCTTGGGGGCAGCTGGCCTGG - Intergenic
1003325470 6:5086865-5086887 TTTCTTGGAGGCAGCTGCTCCGG - Exonic
1007341688 6:41194646-41194668 TGTCTTGGAGGCAGGTCTGGTGG + Exonic
1010710476 6:79168958-79168980 TTTCTGGAGGCCAGCTCAGCAGG + Intergenic
1011161785 6:84399190-84399212 TTTCTTGTAGGCAAATCTGCTGG - Intergenic
1015713937 6:136171337-136171359 TACCTTGCAGGCAGCTCTGCCGG - Intronic
1017416659 6:154228172-154228194 TTTCCTGCAGGCAGCCAAGCAGG + Intronic
1021622652 7:22563719-22563741 TTCCCTGGAGGGAGCTGAGCAGG + Intronic
1024775201 7:52776891-52776913 TTTCTTCTAGGGAGCTCAACAGG - Intergenic
1026780937 7:73266837-73266859 GTTGCTGGAGGCAGCCCAGCTGG - Intergenic
1027021791 7:74820279-74820301 GTTGCTGGAGGCAGCCCAGCTGG - Intronic
1027066230 7:75125638-75125660 GTTGCTGGAGGCAGCCCAGCTGG + Intronic
1028423445 7:90659392-90659414 TTTCTTGCAGACAAATCAGCAGG - Intronic
1030014635 7:105206400-105206422 ATCCATGTAGGCAGCTCAGCAGG - Intronic
1032252146 7:130267261-130267283 TTTGTTCCAGGCAACTCAGCGGG + Intronic
1033658296 7:143387695-143387717 GTTCTTGCAGACAGCTCAGTGGG + Intronic
1033678496 7:143568701-143568723 ATTCTGGGAGACAGCTCAGTTGG + Intergenic
1033693345 7:143760748-143760770 ATTCTGGGAGACAGCTCAGTTGG - Intergenic
1037330654 8:17740770-17740792 TTGCTGGGAAGCAGATCAGCTGG - Intronic
1039318398 8:36399305-36399327 CTTCCTGGAGGTAGCTCACCAGG - Intergenic
1042523416 8:69738832-69738854 TTTCTTGGAGGCAGCTCAGCAGG - Intronic
1043198209 8:77328138-77328160 TTTCTTGGAAGCAACTTAGCTGG + Intergenic
1047188839 8:122659963-122659985 TCCCTAGGAGGCAGCTGAGCTGG + Intergenic
1048533372 8:135270833-135270855 TTGCTTGTTAGCAGCTCAGCAGG - Intergenic
1048542552 8:135355650-135355672 TTTCAGGGAGGTAGCTCAGAGGG - Intergenic
1048855119 8:138680399-138680421 TGTCTTGTAGGTAGCTGAGCTGG + Intronic
1049037985 8:140091473-140091495 TTCCTTGAAGCAAGCTCAGCTGG - Intronic
1049604833 8:143524476-143524498 TTTCTTTGAGGCCGACCAGCTGG - Intronic
1050729458 9:8691306-8691328 TCCCTTGGAGGCAGCACAGTAGG - Intronic
1057227357 9:93299462-93299484 TTGCTTGTAAGCAGCTCAGGGGG + Intronic
1057448309 9:95134680-95134702 TTTGTGGGAGGCAGCTCTGTGGG - Intronic
1059291482 9:113228656-113228678 TTGCTGGGAAGCAGCTAAGCAGG - Intronic
1061393400 9:130330241-130330263 TGTCCTTGGGGCAGCTCAGCAGG - Intronic
1061560039 9:131396004-131396026 TCTCTTGGAGCCTGCGCAGCTGG + Intronic
1203361015 Un_KI270442v1:219180-219202 TTTCTTGGAAGCTGCCCAGCGGG + Intergenic
1185736617 X:2500808-2500830 CTTCCTGGAGCCAGGTCAGCGGG - Exonic
1185855557 X:3531670-3531692 TTTCTTGGAAGTAAATCAGCTGG - Intergenic
1189817892 X:44842528-44842550 TTTGTTGGGGGCAGCTCAGCTGG - Intergenic
1196182984 X:112715387-112715409 TTTCTTCCATGTAGCTCAGCTGG - Intergenic
1196654228 X:118200204-118200226 TTTCTTGGAGGCTGCCCAGCAGG + Intergenic
1201077432 Y:10198359-10198381 TTTCTGGGAAGCTGCCCAGCGGG - Intergenic