ID: 1042525122

View in Genome Browser
Species Human (GRCh38)
Location 8:69756739-69756761
Sequence GAGCACTAGGAAGCAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042525119_1042525122 -3 Left 1042525119 8:69756719-69756741 CCTGAGATTGCCACGTTGCAGAG 0: 1
1: 0
2: 0
3: 11
4: 73
Right 1042525122 8:69756739-69756761 GAGCACTAGGAAGCAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042525122 Original CRISPR GAGCACTAGGAAGCAAACAC AGG Intronic
No off target data available for this crispr