ID: 1042525576

View in Genome Browser
Species Human (GRCh38)
Location 8:69761454-69761476
Sequence CAGTGTAATCAAAGGAAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 359}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042525576 Original CRISPR CAGTGTAATCAAAGGAAAGA CGG (reversed) Intronic
903730868 1:25494380-25494402 TAGTATAAGCAAAGGAAAGAAGG + Intronic
905264204 1:36739890-36739912 CAGTGTACTTGAAGGAAGGAAGG + Intergenic
905746655 1:40423954-40423976 GGGTGTACTCAAAGGAAAGAAGG - Intergenic
906617463 1:47243654-47243676 TAATGTAAGCAAAGGTAAGAAGG + Intergenic
906794836 1:48688597-48688619 CAGTGTAAGCAAAGGGAACGAGG - Intronic
907382299 1:54101325-54101347 CCCTGGTATCAAAGGAAAGATGG + Intronic
907871488 1:58447618-58447640 CAGTGCTATGAAAGAAAAGAAGG + Intronic
908054846 1:60273993-60274015 TAGTCTTATCAAAGTAAAGAAGG - Intergenic
909613540 1:77579959-77579981 CACTGAAATCCAAGAAAAGATGG + Intronic
909882381 1:80896172-80896194 CAGTGTTATCAAATAAGAGATGG + Intergenic
910219723 1:84878230-84878252 CAGTGAAACCAAAGAAAATAAGG - Intronic
910537658 1:88317578-88317600 AAGTGTAATCAAAGATCAGAGGG + Intergenic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
911539172 1:99137873-99137895 CAGAGGAAACAAAGAAAAGAGGG - Intergenic
913342552 1:117773214-117773236 CACTGTAAGCCAAGAAAAGATGG - Intergenic
915064696 1:153215236-153215258 AAGTGAAATGAAAGGATAGATGG - Intergenic
915950015 1:160183467-160183489 CAGGGGAATCAGAGAAAAGAGGG - Intronic
916822553 1:168413761-168413783 CAATGTGATCATAGGAAACAGGG + Intergenic
917787269 1:178472203-178472225 CAGTCTAACTAAAGGAAAGTAGG - Intronic
920707427 1:208264411-208264433 CAGTTTATTGGAAGGAAAGATGG + Intergenic
921003887 1:211073048-211073070 AAAAGTAATCAAAGGAAAGCAGG + Intronic
921507828 1:215994892-215994914 CTGAGTTATCAAAGGAAAAATGG + Intronic
922244832 1:223785982-223786004 CAGTGGAAGGAAAGGAAGGAGGG + Intronic
923261013 1:232268099-232268121 CAATGTGATCAAAGAAAGGAAGG - Intergenic
923782411 1:237036824-237036846 CAGAGTAATCAAAGCCCAGAAGG + Intergenic
923834035 1:237590129-237590151 TAGTGGAATCTAAGCAAAGATGG + Intronic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
1063038218 10:2310183-2310205 CAATGTCATAAAAGGGAAGAGGG + Intergenic
1063051580 10:2455012-2455034 TAATGTAATGAAAGGACAGAAGG - Intergenic
1065865884 10:29915081-29915103 CAGTGGAATCAAAGGACAGCTGG - Intergenic
1067549858 10:47226653-47226675 CACTGTATTCAAGGGAATGAGGG + Intergenic
1069435133 10:68374339-68374361 CACTTTAATCAACGGAAAGCAGG + Intronic
1069713067 10:70502455-70502477 CAATGTATCCAAAGGAAACAGGG - Intronic
1070334844 10:75446182-75446204 CAGTGTAATGAAAAGAACCAAGG + Intronic
1070721860 10:78762519-78762541 TAGTGGAATGAAAGAAAAGAGGG - Intergenic
1071123231 10:82304730-82304752 TAAGGTAATCAAAAGAAAGATGG - Intronic
1071199138 10:83197978-83198000 AAGACTAATCAAAGGAAAGTTGG - Intergenic
1071316556 10:84406406-84406428 CAGTGTAATTAAACTAATGATGG + Intronic
1071675647 10:87653580-87653602 CATTTTAAAGAAAGGAAAGAAGG - Intergenic
1072286138 10:93917363-93917385 CAGTTTAAAAAAAGGAAAGAGGG - Intronic
1072525591 10:96268695-96268717 CAGAGTCATCCAAGGAAAGGAGG - Intronic
1072680861 10:97505387-97505409 AAGTGTATTCAAAGGAGAGGAGG + Intronic
1073933479 10:108602215-108602237 CATTTTAATCAAAGGAATGCTGG - Intergenic
1074230183 10:111525798-111525820 CACTGTAATCAAAGAACATATGG + Intergenic
1074665024 10:115712375-115712397 CAGTGGTATCTAAGGAAAGAAGG + Intronic
1075611052 10:123854975-123854997 CAATGTAACCAAAGTAAAAAGGG - Intronic
1077603973 11:3594666-3594688 GAGTGTAGGCAAAAGAAAGAGGG - Intergenic
1078019366 11:7642438-7642460 CAGGGAGATCAAAGGAAAGTGGG - Intronic
1078134733 11:8642290-8642312 GAGTTAAATCAAAGGAAAGAGGG + Intronic
1078632621 11:13017174-13017196 AAGTGAAACCAAAGGAAAAATGG - Intergenic
1078744837 11:14102664-14102686 CAGTGTCATGAAAGTCAAGAAGG - Intronic
1079878789 11:25896619-25896641 CAATGTATTCAGAGAAAAGAAGG + Intergenic
1081075188 11:38664087-38664109 CAGTGAAATCAAAGAAGAGAAGG - Intergenic
1082741870 11:56919718-56919740 CAGGGCAATCAAGCGAAAGAAGG + Intergenic
1087190067 11:95244875-95244897 CAGTGGCATCACAGGTAAGAAGG + Intergenic
1087316197 11:96606025-96606047 TGGTGTATTCAAAGGAAAGAGGG - Intergenic
1087982706 11:104635931-104635953 CCATGTGATCAGAGGAAAGATGG - Intergenic
1092730540 12:11529502-11529524 CAGTGCAATCAAAATAAAAATGG - Intergenic
1092738272 12:11604708-11604730 CAGGCTAAGCAAAGGAAAAAAGG + Intergenic
1092813371 12:12291833-12291855 AACTGTACTCAAAGGCAAGAAGG - Intergenic
1093179367 12:15949996-15950018 CAGTGTAATCAGGGGAAAGTAGG - Intronic
1093868146 12:24253493-24253515 CAGTGTCTTTAAAGCAAAGATGG + Intergenic
1093913559 12:24774710-24774732 CATTTTAATCATAGGAAATATGG - Intergenic
1095605153 12:44058832-44058854 CAGAGAAATCAACTGAAAGAAGG + Intronic
1095716683 12:45353774-45353796 CAGAGTAATAAAAGAAAATAGGG + Intronic
1098896757 12:76071497-76071519 CACTGAAATCAAAGAAAACAAGG + Intronic
1099150036 12:79099020-79099042 CATTGTAAGCACAGGAAAGGAGG + Intronic
1099257495 12:80331901-80331923 CAATAGAATCAGAGGAAAGAAGG + Intronic
1099787981 12:87291891-87291913 AAATGTAATCAAAGGAAAGCTGG + Intergenic
1099812966 12:87608347-87608369 CAGTCAAATCAAAGGATAGAAGG + Intergenic
1100081146 12:90852319-90852341 AAGTTTTATTAAAGGAAAGAGGG + Intergenic
1101532784 12:105589732-105589754 TAGTTTAATGAAAGCAAAGATGG + Intergenic
1102826854 12:115954089-115954111 AATTCTAATCAAAGGAAAGAGGG + Exonic
1104372781 12:128237989-128238011 AGGTGTAATTAAGGGAAAGATGG + Intergenic
1104427999 12:128693864-128693886 CAAAGAGATCAAAGGAAAGATGG + Exonic
1105610738 13:21967605-21967627 CAGGGTCATCATAGGAAAAAAGG - Intergenic
1106634941 13:31518594-31518616 CAGTGGAATCTGAGGAAAGCTGG + Intergenic
1106744554 13:32686149-32686171 CACTGTAATCAAAAGGAAGCTGG - Intronic
1107023559 13:35776781-35776803 CAGTGAAACTGAAGGAAAGAGGG - Intronic
1107135186 13:36936836-36936858 AACTTTAATCAAAGGAAAGCAGG - Intergenic
1107275453 13:38673480-38673502 TACTGTCATCAAAGGAAGGAAGG - Intergenic
1107682147 13:42863246-42863268 CAATGTAAGCAAAGGAGACAGGG + Intergenic
1108551369 13:51549005-51549027 CAGTGTAAAAAAAGCAAACATGG - Intergenic
1109035142 13:57248814-57248836 AAGTGTAAACCAAGAAAAGAGGG - Intergenic
1109741286 13:66559298-66559320 CTTTGTAAGCATAGGAAAGAAGG - Intronic
1109971753 13:69779439-69779461 CAGTAAAAGGAAAGGAAAGAAGG - Intronic
1110066893 13:71119487-71119509 CTGTTTAATTAAAAGAAAGAAGG - Intergenic
1110326805 13:74225838-74225860 CAGTCTAAGAAGAGGAAAGAGGG + Intergenic
1110924741 13:81137452-81137474 CAGCATTATCAAGGGAAAGAAGG + Intergenic
1110988396 13:82004570-82004592 TAGTGTAAGAAAATGAAAGATGG - Intergenic
1111069486 13:83145915-83145937 CAGTGTATTCAAGGCAAGGATGG + Intergenic
1111632565 13:90861240-90861262 AAGCATAATCAAAGGAAAAAGGG + Intergenic
1111720749 13:91941132-91941154 CAGTGTTATCAAAGATCAGATGG + Intronic
1111878794 13:93929786-93929808 CAATGTATTTAAAAGAAAGAAGG + Intronic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1112630839 13:101159802-101159824 TCGTGTCATCAAAGAAAAGAGGG + Intronic
1112928528 13:104706705-104706727 TAGTGTAAAGAAAGGAAAAAAGG - Intergenic
1114733578 14:25020391-25020413 CAATGAAATCAAAGGTAAGGAGG + Intronic
1115153423 14:30311718-30311740 CAGTTGAATCATATGAAAGATGG + Intergenic
1115156304 14:30343174-30343196 CAGTTTTATCAAAGGTCAGATGG + Intergenic
1115909049 14:38235215-38235237 CCATGTAAGCAAAGGAAGGAGGG - Intergenic
1115946217 14:38664192-38664214 CAGTGAAATAGAAGGAAGGAGGG + Intergenic
1116007870 14:39315913-39315935 CAATGTGATAAAAGCAAAGAAGG - Intronic
1116808416 14:49515975-49515997 CAGTGTAATCCTGGAAAAGAGGG + Intergenic
1117275970 14:54193898-54193920 AAATGTTATCATAGGAAAGAAGG - Intergenic
1117316653 14:54577371-54577393 CAGTGTTATCCAAGCTAAGAAGG + Intronic
1117827584 14:59719567-59719589 TGGTTGAATCAAAGGAAAGATGG + Intronic
1118210048 14:63757551-63757573 CTGTGTAAGCAACAGAAAGAGGG - Intergenic
1120587610 14:86333370-86333392 CAGTTTAATCATAGTCAAGAGGG + Intergenic
1120831802 14:89004003-89004025 AAGTGAAATCAAAGGTAATAAGG - Intergenic
1121931072 14:97972710-97972732 CAGTGTGATCAATGGATAAAGGG - Intronic
1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG + Intronic
1123436772 15:20260347-20260369 CATTGAAAGCAAAGGAAAGGGGG - Intergenic
1124144305 15:27108890-27108912 AACTTTAATCAAAGGAAAGTTGG - Intronic
1124809628 15:32922217-32922239 CAGTTTTATGGAAGGAAAGAAGG + Intronic
1125307805 15:38341197-38341219 AAGAATAATCAAAGGAGAGAAGG - Intronic
1126347889 15:47716230-47716252 CTGTGTAACCCAAGGAAAGAAGG - Intronic
1126776260 15:52103184-52103206 CATTATTATAAAAGGAAAGAAGG - Intergenic
1130246436 15:82254270-82254292 CAGTGGGATCTAAGGAGAGATGG - Intronic
1133176580 16:4019680-4019702 CACTGTTGTCAAAGGAGAGATGG + Intronic
1134587127 16:15421314-15421336 CAGTGGAATCAAAGACAGGATGG - Intronic
1135558595 16:23457356-23457378 AAGTGTAATCATAAGAAAGCTGG - Intergenic
1135816279 16:25636985-25637007 CAGTATAATAAAAGGTAAGGAGG + Intergenic
1136678051 16:31932429-31932451 AATAGTAATCAAAGGAAAGGTGG + Intergenic
1136695310 16:32075147-32075169 CAGTGTTGTCAAAGAAAAGTTGG - Intergenic
1136795809 16:33018404-33018426 CAGTGTTGTCAAAGAAAAGTTGG - Intergenic
1136866775 16:33765633-33765655 CACTGTACCCCAAGGAAAGAAGG + Intergenic
1136874111 16:33835976-33835998 CAGTGTTGTCAAAGAAAAGTTGG + Intergenic
1137484271 16:48878603-48878625 CAGTTTCATCAAGGGAAACAAGG + Intergenic
1138039813 16:53650916-53650938 GAATGTAAATAAAGGAAAGAAGG - Intronic
1140017414 16:71200942-71200964 CAGTTTGATCAAAGGAAACAGGG - Intronic
1141684608 16:85563105-85563127 CCGTGTATTCGAAGGGAAGAGGG + Intergenic
1203098066 16_KI270728v1_random:1280059-1280081 CAGTGTTGTCAAAGAAAAGTTGG - Intergenic
1203105387 16_KI270728v1_random:1350569-1350591 CACTGTACCCCAAGGAAAGAAGG - Intergenic
1203128127 16_KI270728v1_random:1611799-1611821 CACTGTACCCCAAGGAAAGAAGG + Intergenic
1143054909 17:4155574-4155596 CAGTGTCATCTCAAGAAAGAGGG + Intronic
1144802340 17:17938372-17938394 CAGTGAAATCAAAGGCACCAAGG - Intronic
1144842440 17:18195934-18195956 AAGTTTAATAAAAGGAAGGAAGG - Intronic
1146691163 17:34877151-34877173 CAGTGGAATCATAGGAGACAGGG - Intergenic
1149064208 17:52460821-52460843 CAGTATCTTCAAAGGAAAGAAGG + Intergenic
1149771848 17:59328705-59328727 CAGTTTGAGCAAAGGACAGATGG + Intergenic
1150544884 17:66145585-66145607 CAGTGGAATTGAGGGAAAGAAGG - Intronic
1150896733 17:69220287-69220309 CAGTATATGAAAAGGAAAGAAGG + Intronic
1152260822 17:79266116-79266138 CATTGGAATCAAAGGAAGGAGGG - Intronic
1152341340 17:79727320-79727342 CACTGTACCCCAAGGAAAGAAGG + Intergenic
1152466177 17:80467868-80467890 CTGTGTTATCAAAAGCAAGAAGG + Exonic
1154206604 18:12342728-12342750 CAGAGTATTCACAGGAAAAATGG - Intronic
1154976628 18:21463464-21463486 CAGGGTTCTCAAATGAAAGATGG + Intronic
1155260713 18:24039375-24039397 AAGTGTATTCAAGGGAATGATGG + Intronic
1155532374 18:26780361-26780383 CAGGGGAATCAAAGGTAAGGAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155884454 18:31190287-31190309 CATAGTAATCAACTGAAAGAAGG - Intergenic
1156624468 18:38891833-38891855 AAGTGTTTTCAAAGGAAACAAGG + Intergenic
1156783976 18:40886864-40886886 AACAGTAATCAAAGGAAAGCAGG - Intergenic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1158279520 18:55806950-55806972 CAGTGCTATCAACAGAAAGAAGG - Intergenic
1158885041 18:61819039-61819061 CAGCATGAGCAAAGGAAAGAAGG + Intronic
1165189815 19:34053310-34053332 TAGGGTTACCAAAGGAAAGAAGG + Intergenic
1165537967 19:36465977-36465999 CAGTTTAATAGAAGGAAAAAAGG + Intronic
1166479894 19:43162499-43162521 AAGTGTAATGAGAGGAAAGTAGG - Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
1167947916 19:53004011-53004033 TAGTGTTTTCAAAGGAGAGAAGG - Intergenic
925498706 2:4480986-4481008 CACAGGAAACAAAGGAAAGAAGG + Intergenic
926790804 2:16569488-16569510 CAGTTTCATGACAGGAAAGAAGG - Intronic
927063948 2:19450681-19450703 CACTTTTCTCAAAGGAAAGAGGG + Intergenic
927374103 2:22393221-22393243 CAGCATAATAAAAGGAAAGATGG - Intergenic
927477574 2:23425698-23425720 CAGTCTAATCTAAGGCAAGCTGG - Intronic
929132607 2:38593146-38593168 CTGTTTAACCATAGGAAAGACGG - Intronic
929784225 2:44977541-44977563 CAGTTTAATCACCGCAAAGAGGG - Intergenic
930469776 2:51797405-51797427 CAGTTTAAAAAAAGCAAAGAGGG + Intergenic
932820055 2:74891869-74891891 CAGTGTAGTTAAAGGGCAGAAGG + Exonic
935521990 2:104118845-104118867 GTGTGTGATCAAAGGACAGAAGG + Intergenic
935918533 2:107985431-107985453 CAGTGTAAGAAAAGGGGAGATGG + Intergenic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
936689068 2:114864424-114864446 AAGTGTTATTAAAGGAAATAGGG + Intronic
937810390 2:126193297-126193319 CAGTGCTGTCAAAGCAAAGATGG - Intergenic
938195460 2:129323628-129323650 CACTGTAAGCAAAGAGAAGAGGG + Intergenic
939215139 2:139227571-139227593 CAGTGTTACCACAGAAAAGAGGG - Intergenic
940377659 2:152973891-152973913 CAATGTCAACAAAGGAAAAAGGG - Intergenic
940552455 2:155177931-155177953 CAGTGTCATCATATGATAGATGG - Intergenic
941544881 2:166836605-166836627 CAGTGTAAGCAAAATATAGATGG + Intergenic
941602036 2:167554948-167554970 CAGTGAAATATAAGGTAAGAAGG + Intergenic
943810384 2:192180357-192180379 AATTGTAATTAAAGGAAGGAAGG - Intronic
944472694 2:200071938-200071960 CAGTATAATCAAAGGCATGGAGG + Intergenic
945692235 2:213051689-213051711 CATAGTAATAAAAGGAAAGATGG + Intronic
946680573 2:222210786-222210808 GAGTGACATCAAAGGAAAGGCGG - Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
948002858 2:234582430-234582452 CAGAGGAGGCAAAGGAAAGAGGG - Intergenic
948189978 2:236051074-236051096 CAGTGTGACTAAAGAAAAGATGG - Intronic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1171105916 20:22432269-22432291 CAGTGTAATTTATGGAAAGATGG + Intergenic
1171136288 20:22697585-22697607 GAGTGGAATCAAAAGAAAGTGGG - Intergenic
1171938466 20:31300107-31300129 CAGAAGAATAAAAGGAAAGATGG + Intergenic
1172420828 20:34816131-34816153 GAGAGTAACCAAAGGAATGATGG - Intronic
1173124954 20:40328112-40328134 CAGTGTGAAGAAAGGAAAAAAGG - Intergenic
1175143736 20:56880500-56880522 CAGTGTTGTCAAAGAAAATACGG - Intergenic
1175621993 20:60455103-60455125 CAGTGAAACCAGAGGACAGATGG + Intergenic
1176553242 21:8239295-8239317 CAGTGAAAACCAATGAAAGAGGG - Intergenic
1176572164 21:8422319-8422341 CAGTGAAAACCAATGAAAGAGGG - Intergenic
1176580073 21:8466879-8466901 CAGTGAAAACCAATGAAAGAGGG - Intergenic
1176698483 21:10011121-10011143 CAGTCTAATCACTGGTAAGATGG - Intergenic
1177667099 21:24174565-24174587 TAATGTAATCACAGGGAAGAGGG - Intergenic
1179081884 21:38178984-38179006 AACTGTACTGAAAGGAAAGATGG - Intronic
1179425217 21:41272403-41272425 CAGAGTACTCAAAAGGAAGAAGG - Intronic
1180197094 21:46203540-46203562 CACTGTAATAAAAGTAAAGCAGG - Intronic
1182977993 22:34641277-34641299 GAGTCTTATCAAAGGAAAAACGG + Intergenic
1185200639 22:49502154-49502176 CAGTGACATCAAAGAACAGAGGG - Intronic
1203258240 22_KI270733v1_random:156323-156345 CAGTGAAAACCAATGAAAGAGGG - Intergenic
951454965 3:22881056-22881078 CAGAGTAATCAAATAAATGAAGG + Intergenic
951983800 3:28595501-28595523 CAGTCTGAGGAAAGGAAAGAGGG + Intergenic
952168914 3:30783637-30783659 CAGTGTAATAAAAAGAAAAGCGG + Intronic
952928912 3:38344651-38344673 CAGTCTAGTCACAGGCAAGAAGG + Intergenic
954384831 3:50238522-50238544 CAGAGTAAGCAAAGGCCAGAAGG - Intronic
954801697 3:53190718-53190740 GAGGGGAATCAAAGGACAGAAGG - Intronic
955670921 3:61401642-61401664 TAGTGTACTAAAAGCAAAGATGG - Intergenic
955744421 3:62125915-62125937 CAGTGTATTAAAAAGACAGAAGG + Intronic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
957225199 3:77434187-77434209 CAATGTATTCAAAGGCAAGAAGG - Intronic
957951268 3:87130097-87130119 TAGTGAAATTAAAGGAAAAAGGG + Intergenic
958842839 3:99229039-99229061 CAGAGGAATCAAAAGAAGGAAGG + Intergenic
958885393 3:99721006-99721028 CAGGTGAACCAAAGGAAAGAAGG + Intronic
958896524 3:99835921-99835943 CAGCATGATCAAAGGTAAGAAGG + Intronic
959118272 3:102203775-102203797 CAGAGGAAAAAAAGGAAAGAAGG - Intronic
959276365 3:104281958-104281980 CAGTGCAATAAAAGCAAAGGCGG + Intergenic
959782261 3:110248328-110248350 GTGTCTAATCTAAGGAAAGAGGG - Intergenic
959902899 3:111679930-111679952 CAGTGGAAAGAAAGCAAAGAGGG - Intronic
959973663 3:112434470-112434492 CAGTTTACTCAACTGAAAGATGG + Intergenic
960329753 3:116344224-116344246 CAGTGTAATCACAGCAGAGTTGG - Intronic
961777372 3:129298201-129298223 CTCTGTCACCAAAGGAAAGAAGG - Intronic
962129014 3:132652560-132652582 CAGTGTAAGCAAAAAAAAAATGG - Intronic
962250041 3:133830490-133830512 CAGCATGAACAAAGGAAAGAAGG - Intronic
963031596 3:140983645-140983667 CAATTTAATCAAAGTAAGGAGGG + Intergenic
963291057 3:143489716-143489738 CAGTGTAAACAGAGTAAAAAAGG + Intronic
963707162 3:148701721-148701743 CATTGTAATAATAGGAAACAAGG - Intronic
964322550 3:155513373-155513395 CAGTGAAAGCAAAAGATAGAAGG + Intronic
964376876 3:156056565-156056587 CAGTGTAATCAAGATACAGATGG + Intronic
964925700 3:161954271-161954293 CAGGGAAATCAAAGCAAAAATGG - Intergenic
965198227 3:165625681-165625703 TATTTTACTCAAAGGAAAGAGGG + Intergenic
965631802 3:170740817-170740839 CACTATATACAAAGGAAAGAAGG + Intronic
965946567 3:174249176-174249198 CAGTGACATCATAGAAAAGATGG - Intronic
968243949 3:197122481-197122503 CAGTATAAAGATAGGAAAGAAGG + Intronic
969753298 4:9129687-9129709 CACTGCAATCAAAGTAAAAATGG - Intergenic
970738754 4:19207197-19207219 CAGTGAAATCAAAGGCAATATGG - Intergenic
971182215 4:24339464-24339486 CAGTGTGAACAAAGGTAAAAAGG - Intergenic
971319701 4:25595497-25595519 AACTGGAATTAAAGGAAAGAGGG - Intergenic
973206077 4:47561667-47561689 CAGTTTAATCCAAGACAAGAGGG - Intronic
973608752 4:52613211-52613233 CACTGGAAAGAAAGGAAAGAGGG + Intronic
974300189 4:60054625-60054647 CAGTGTAGTAAAAGGATAAAAGG + Intergenic
974397482 4:61357555-61357577 CAGTGTAAACTAAAGAAAGCAGG - Intronic
975464468 4:74693857-74693879 CAGTGTAATCTAAGAGCAGAAGG + Intergenic
976190337 4:82480886-82480908 CAGTGTGAGCAACTGAAAGACGG + Intergenic
976423499 4:84872803-84872825 AACTCTAATCAAAGGAAAGCTGG + Intronic
977161894 4:93645182-93645204 CACAGAAATCAACGGAAAGAGGG + Intronic
977262087 4:94809619-94809641 CAATGTACACAAAAGAAAGAGGG - Intronic
977493684 4:97746657-97746679 CAGTGGAATAAAAGAAAGGAGGG + Intronic
977662233 4:99603231-99603253 CAGTGGAGACACAGGAAAGATGG + Intronic
977740207 4:100470943-100470965 CAGAGAAAGCAATGGAAAGAAGG + Intronic
979131317 4:117049214-117049236 TAATGAAATCAAATGAAAGAGGG + Intergenic
979493679 4:121360226-121360248 CAGTGTAATCTAATGTAAAATGG + Intronic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
979548980 4:121969143-121969165 CAGTGGAAGAAAAGGAAGGAGGG - Intergenic
979800770 4:124905996-124906018 CAGTATAATTAAATGATAGAAGG - Intergenic
982697640 4:158621469-158621491 TAGTATCATCAAAAGAAAGAAGG + Intronic
983423688 4:167554347-167554369 CACTGTAAAGAAATGAAAGATGG + Intergenic
984105686 4:175542189-175542211 CAGTGTAAACCAAGGAATGTAGG + Intergenic
985989214 5:3541450-3541472 CAGGATAATCAAATGAAAAAAGG + Intergenic
986073805 5:4313690-4313712 CAGTGGAAGAAAAGGAAAGCAGG - Intergenic
987285617 5:16453680-16453702 GAGTTTAAGCAAAGGAAAGGTGG - Intronic
987954676 5:24723090-24723112 CAGAGTAGTCATAGGGAAGAAGG - Intergenic
989362348 5:40617040-40617062 CAGAGTTATATAAGGAAAGATGG - Intergenic
990316984 5:54591969-54591991 CAGAGTAAGCAAAGTACAGAAGG - Intergenic
990986820 5:61648467-61648489 CAGAGTGAACAAAGGAAAGTAGG + Intronic
992963255 5:81976351-81976373 CATGGTGGTCAAAGGAAAGAAGG + Intronic
995365374 5:111353958-111353980 CAGTGAATCCAAAGGAAATAAGG + Intronic
995627650 5:114096794-114096816 CCATGCAAACAAAGGAAAGATGG + Intergenic
996370344 5:122746672-122746694 ATGTGTAAGAAAAGGAAAGAGGG + Intergenic
996988227 5:129594598-129594620 CATTATAATCAAATGGAAGAAGG - Intronic
998743912 5:145235220-145235242 CAGAGTATAGAAAGGAAAGAGGG + Intergenic
998915377 5:147005951-147005973 CAGTGTAAACAAGGGAACAAGGG + Intronic
999522476 5:152364874-152364896 CAGTCAAATGAGAGGAAAGATGG - Intergenic
999576923 5:152989026-152989048 CACTTTATTCAAAGGACAGAAGG + Intergenic
1001735949 5:174001584-174001606 CAGTATATTCAAAGGAAAAGAGG - Intronic
1001847357 5:174933959-174933981 CAGCTTAATTCAAGGAAAGAGGG + Intergenic
1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG + Intronic
1002625478 5:180525203-180525225 CTGTTTAATCAAAGCACAGAAGG - Intronic
1003725000 6:8751166-8751188 CAGTTTTATCACAGGAAAAATGG + Intergenic
1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG + Intronic
1004757034 6:18621477-18621499 CATTTTAATCAAAGGAATAAAGG - Intergenic
1005454541 6:26006509-26006531 GAGTGTAGACACAGGAAAGAGGG - Intergenic
1005531431 6:26710697-26710719 CAGAGAAAGGAAAGGAAAGAAGG - Intergenic
1005539364 6:26790965-26790987 CAGAGAAAGGAAAGGAAAGAAGG + Intergenic
1005650833 6:27883391-27883413 AAGTTTATTCAAAGGAAAGCTGG + Intergenic
1006541685 6:34745095-34745117 CAGTGTATTCAATGGAAAGTGGG + Intergenic
1007134439 6:39507735-39507757 CAGTGTGATGGAAGGAAGGAAGG - Intronic
1007287137 6:40755670-40755692 GAGTTTAGTCAAAGGAGAGAAGG + Intergenic
1007288259 6:40763770-40763792 GAGTGTAATAAAAGGCTAGAGGG + Intergenic
1007777994 6:44234447-44234469 CAGTGAAGACAAAGGAAAGATGG - Intergenic
1008119019 6:47588944-47588966 CAGTGTAATCATATGAAAGTAGG + Intronic
1008224496 6:48897467-48897489 CAGAGTAATCAAAAGACAGTTGG - Intergenic
1009298744 6:61988237-61988259 CTGTTTAATCAAGGAAAAGAAGG + Intronic
1009383392 6:63060699-63060721 CAGTTAAATCAATGGAAACAAGG - Intergenic
1009400365 6:63247414-63247436 AAGTGTAAGGAAAGGAAAAAAGG - Intergenic
1009811894 6:68678583-68678605 GGGTGTAATCAAAGGAAGGTTGG + Intronic
1010391852 6:75346773-75346795 AAGTGTAATTAAAGTAAAGGAGG - Intronic
1011385120 6:86788047-86788069 CAGTGTAAAGAAAGGCAAGCTGG + Intergenic
1011909027 6:92411306-92411328 AAGTGTAATCAAAGTCAAGAAGG + Intergenic
1012119769 6:95351792-95351814 GAGTGTAATCAATTAAAAGAAGG - Intergenic
1012567966 6:100684119-100684141 GGGTGTATTCAAAGGAAAGAAGG + Intronic
1013602462 6:111717959-111717981 CAAAGAAATCTAAGGAAAGAAGG - Intronic
1013734089 6:113205641-113205663 CAGTAAAATCAAAGGAAAGAGGG - Intergenic
1013868729 6:114729330-114729352 CAGAGTAATCAATGGAATGTTGG + Intergenic
1014499425 6:122166645-122166667 CAGATAAATCAAAAGAAAGATGG + Intergenic
1014941454 6:127444927-127444949 CATTAAAATAAAAGGAAAGAAGG - Intronic
1015224308 6:130838978-130839000 CAGTGGACACAAAGTAAAGAAGG + Intergenic
1015262828 6:131257859-131257881 AAGTGTAAACAAAGAAAAAAGGG - Intronic
1017054720 6:150426481-150426503 CAGTGTTCTCAGAGGAAGGAGGG + Intergenic
1017212529 6:151872702-151872724 TACTGTAACCAAAGCAAAGAGGG - Intronic
1017614882 6:156235651-156235673 CAGTAAATTCAAAGGTAAGAAGG + Intergenic
1019746752 7:2704978-2705000 TAGTGTAATCATCGGACAGACGG - Intronic
1021383736 7:20002325-20002347 AATTATAATCAAAGGAAACAAGG - Intergenic
1021503259 7:21352938-21352960 GTGTCTAATCAAATGAAAGAAGG + Intergenic
1021654167 7:22858580-22858602 CAGTGAAATCTATGGCAAGATGG + Intergenic
1022601446 7:31764067-31764089 CATTTTAAGCAAAGGAAAAATGG + Intronic
1023356447 7:39371697-39371719 CAGTGGAGTCAAATGACAGAGGG - Intronic
1023728924 7:43171608-43171630 CAGTACAATGAAAGGAAAAAAGG + Intronic
1024963089 7:54997774-54997796 CTGTTTAAGCAAAGAAAAGAGGG - Intergenic
1026121735 7:67543714-67543736 GAGTGTGATCAACTGAAAGAAGG - Intergenic
1028728340 7:94115392-94115414 CAGTGTGTTGTAAGGAAAGATGG + Intergenic
1029669918 7:102022697-102022719 CTGTGTACTCAAAGGAGAGGAGG + Intronic
1029959898 7:104679567-104679589 CACTGTAGCCAAATGAAAGAAGG + Intronic
1030821775 7:114101493-114101515 CAGTGTCAGAAAAGGAAACAAGG + Intronic
1031611038 7:123827476-123827498 CAATTGAAGCAAAGGAAAGAAGG - Intergenic
1031896874 7:127360316-127360338 TAGTGTAATCAAAGGAATTTTGG + Intronic
1032401846 7:131629395-131629417 CAGGGGAAGCAAAGGAAATAGGG - Intergenic
1033631900 7:143166495-143166517 CAGTGTGACCAAAGAAAGGAAGG - Intergenic
1034041262 7:147879613-147879635 CACTGTAATCAAAAGACTGATGG + Intronic
1037106072 8:15110550-15110572 AAGTGAAATCAAAGCAAAGCAGG + Intronic
1037251460 8:16900159-16900181 CAATGCAAACAAAGGGAAGAAGG + Intergenic
1037292085 8:17361495-17361517 CTGTGTTCTAAAAGGAAAGAAGG - Intronic
1037536672 8:19831039-19831061 CAGTATACTCAAAGGAAAATAGG - Intronic
1038079141 8:24112908-24112930 CAGTGAAATCAAAGACAACATGG - Intergenic
1038137355 8:24802157-24802179 AAGTTTACCCAAAGGAAAGAAGG - Intergenic
1038622601 8:29158009-29158031 CAGTGTGCTCAAAGAACAGATGG - Intronic
1041648347 8:60276795-60276817 GAGTGAAATCATAAGAAAGAGGG + Intronic
1042525576 8:69761454-69761476 CAGTGTAATCAAAGGAAAGACGG - Intronic
1042662690 8:71173101-71173123 GAGTGTAAAGGAAGGAAAGAAGG + Intergenic
1043614160 8:82104689-82104711 CATTGTAATGGAAAGAAAGATGG + Intergenic
1043674072 8:82927398-82927420 ATGTGGAAACAAAGGAAAGAAGG + Intergenic
1044038826 8:87339688-87339710 CACAGTAACCAAAGGAAAAAAGG - Intronic
1046762009 8:118031098-118031120 CAGTCTAAACAAAGTACAGATGG + Intronic
1046774973 8:118154261-118154283 CAGTGTGATGAGAGGACAGATGG - Intergenic
1047814086 8:128443811-128443833 CAGTGTAAGCAAAGTCCAGAAGG - Intergenic
1048566344 8:135601777-135601799 GAGTGGAATCAAAGTATAGAAGG - Intronic
1048673908 8:136754918-136754940 CAGTTGAAAGAAAGGAAAGAGGG - Intergenic
1048722737 8:137345060-137345082 CAAGGGAAACAAAGGAAAGAAGG - Intergenic
1048791810 8:138111113-138111135 CTCTGTAGTCTAAGGAAAGAAGG + Intergenic
1049130018 8:140830674-140830696 CAGTATATTCACAGGAAGGATGG + Intronic
1050326749 9:4505348-4505370 CAGTATAAAAAAAGGAAATATGG - Intronic
1050812605 9:9768547-9768569 CAGAGAAATCAAAGTAAAAATGG + Intronic
1051189432 9:14495641-14495663 CAGTGTAATTAAAAATAAGAAGG + Intergenic
1051470991 9:17441867-17441889 AAGGGTAAGCAAAGGAGAGAAGG + Intronic
1051518714 9:17960095-17960117 CAATGGAAACACAGGAAAGAAGG - Intergenic
1051891024 9:21943139-21943161 CAGTGTTCTCAAAGGAGAGTTGG + Intronic
1052161152 9:25261591-25261613 CAGTGTTATCAAATGGAGGATGG - Intergenic
1052348291 9:27432105-27432127 AAGTTTAATTAAAGGGAAGAAGG + Intronic
1052548435 9:29912301-29912323 CAAGGTAATGAAATGAAAGACGG - Intergenic
1053371687 9:37566945-37566967 CAGTGCATTGAAAGGAGAGAGGG - Intronic
1054351331 9:64019164-64019186 CAGAGTAATCAGACAAAAGAAGG - Intergenic
1054913789 9:70477878-70477900 TAGTGTAATCAAAGGAATCTGGG + Intergenic
1055896960 9:81188233-81188255 CAGTGAAATGAAAAGAAAGCGGG - Intergenic
1057006171 9:91562171-91562193 CAGTGTCAAAAAAGGAAGGAAGG + Intergenic
1057544177 9:96005015-96005037 CAGTGTAAAAAAAGGACAGCAGG + Intronic
1058567137 9:106298054-106298076 CAGTGTAGTCAGAGAAAAGAGGG + Intergenic
1058773973 9:108266041-108266063 CAGTATTATCAATGGAAAAATGG + Intergenic
1059725259 9:117002446-117002468 CAGAGTAAGCAATGGAAAGAGGG + Intronic
1060085635 9:120697963-120697985 CAGTTTAATCAAAGGAAAAAAGG + Intronic
1203474434 Un_GL000220v1:138337-138359 CAGTGAAAACCAATGAAAGAGGG - Intergenic
1188785520 X:34341461-34341483 CAGTCTTATCAAATGAATGAAGG + Intergenic
1189586014 X:42462867-42462889 CTGTGGAATAGAAGGAAAGAGGG - Intergenic
1190413714 X:50161886-50161908 CAAATTAATCAAATGAAAGAGGG - Intergenic
1190595819 X:52052080-52052102 CACTGGAATAAATGGAAAGAAGG + Exonic
1190613005 X:52201993-52202015 CACTGGAATAAATGGAAAGAAGG - Exonic
1192291883 X:69806178-69806200 CAGTGTAATGAAAGGAATACTGG + Intronic
1194809059 X:98368072-98368094 CAATGAAAGCAAAGGAAATAAGG + Intergenic
1195870174 X:109477521-109477543 GAGTGTAATCAATTGATAGAGGG + Intronic
1196002203 X:110797441-110797463 CACTGTTAACAAAGGAAAGGGGG + Intergenic
1196150181 X:112365012-112365034 CAGTGTAATAGAATGTAAGATGG + Intergenic
1196987230 X:121288487-121288509 GAAAGAAATCAAAGGAAAGATGG - Intergenic
1197658551 X:129144977-129144999 CAATGTATACACAGGAAAGATGG + Intergenic
1198977666 X:142355077-142355099 TAGTGTCATGAAAGAAAAGAAGG - Intergenic
1199327762 X:146520964-146520986 CAATATAATCAAAAGAAAGCAGG + Intergenic
1199621952 X:149709626-149709648 CAGTGTACTAAATGGAAAAACGG + Intronic
1201345351 Y:12977394-12977416 GAGTGTCTTCAAAGGAAGGAAGG + Intergenic
1201622378 Y:15974253-15974275 CATTTAAATCAGAGGAAAGAGGG - Intergenic