ID: 1042530684

View in Genome Browser
Species Human (GRCh38)
Location 8:69811749-69811771
Sequence TTAGTGTTTAACCATGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042530681_1042530684 21 Left 1042530681 8:69811705-69811727 CCTGAACGGAATTAAATTTTAAA 0: 1
1: 0
2: 2
3: 43
4: 512
Right 1042530684 8:69811749-69811771 TTAGTGTTTAACCATGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042530684 Original CRISPR TTAGTGTTTAACCATGTGCC AGG Intronic
No off target data available for this crispr