ID: 1042530704

View in Genome Browser
Species Human (GRCh38)
Location 8:69811865-69811887
Sequence CTGGCCAGTGGTGCAAACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042530704_1042530714 17 Left 1042530704 8:69811865-69811887 CCCCAGTTTGCACCACTGGCCAG 0: 1
1: 0
2: 1
3: 19
4: 186
Right 1042530714 8:69811905-69811927 AACCGAGGCAGCTGGACCCCAGG No data
1042530704_1042530713 9 Left 1042530704 8:69811865-69811887 CCCCAGTTTGCACCACTGGCCAG 0: 1
1: 0
2: 1
3: 19
4: 186
Right 1042530713 8:69811897-69811919 GGAATTCAAACCGAGGCAGCTGG No data
1042530704_1042530712 2 Left 1042530704 8:69811865-69811887 CCCCAGTTTGCACCACTGGCCAG 0: 1
1: 0
2: 1
3: 19
4: 186
Right 1042530712 8:69811890-69811912 CAAAGTGGGAATTCAAACCGAGG No data
1042530704_1042530717 19 Left 1042530704 8:69811865-69811887 CCCCAGTTTGCACCACTGGCCAG 0: 1
1: 0
2: 1
3: 19
4: 186
Right 1042530717 8:69811907-69811929 CCGAGGCAGCTGGACCCCAGGGG No data
1042530704_1042530715 18 Left 1042530704 8:69811865-69811887 CCCCAGTTTGCACCACTGGCCAG 0: 1
1: 0
2: 1
3: 19
4: 186
Right 1042530715 8:69811906-69811928 ACCGAGGCAGCTGGACCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042530704 Original CRISPR CTGGCCAGTGGTGCAAACTG GGG (reversed) Intronic
901415274 1:9112085-9112107 CAGGCCTGTGGTGCAGACAGTGG + Intronic
901691874 1:10978905-10978927 ATGGCCAGGGGTGCAGGCTGGGG + Intronic
902228147 1:15009663-15009685 CTGCCCAGTGGTCCAAATGGTGG - Intronic
902542439 1:17164635-17164657 CTGGCCACTTGAGGAAACTGAGG - Intergenic
903134837 1:21302719-21302741 CGGGCCAGGGGAGGAAACTGAGG - Intronic
903182409 1:21611607-21611629 CTGGCCAGGGCTGGAGACTGAGG - Intronic
903440230 1:23382523-23382545 CTGGCCAAAGGGGCAAGCTGAGG + Intronic
905274793 1:36810227-36810249 CTGGCCAGTGATGGGAACTCAGG - Intronic
906930887 1:50168202-50168224 GAGGCCATTGGCGCAAACTGGGG + Intronic
907726466 1:57025067-57025089 CTGCGCAGTTGTGCAAACCGAGG - Intronic
909388617 1:75091010-75091032 CTGTACATTGGTGCAAAGTGAGG - Intergenic
909587024 1:77301506-77301528 ATGGCCAGAGAGGCAAACTGTGG - Intronic
913037312 1:114983156-114983178 TTAGCCAGTGGTGAAAACTTAGG + Intronic
915081455 1:153355482-153355504 CTGGACAGTGGTGGCAACTGTGG - Intergenic
915122841 1:153642309-153642331 CTGGCCAGGGGAGCAATCGGAGG + Exonic
915489238 1:156242269-156242291 CTGGCCAGCGATGCAAAGTGCGG - Exonic
920836677 1:209517580-209517602 CTGGACAGTGGTGCTGGCTGTGG - Intergenic
923145813 1:231196924-231196946 CTGGCCTGGGGTGCAAACCCTGG - Intronic
1063344630 10:5299502-5299524 CTGGGCAGTGGTGCTGCCTGTGG - Intergenic
1063640602 10:7826893-7826915 CTGATTAGTGGTGCAAAGTGAGG + Intronic
1067088605 10:43255362-43255384 CTGGACAGTGGGGCAGGCTGAGG + Intronic
1069573646 10:69509237-69509259 CTGGCCAGCGGTGCAGTGTGAGG - Intergenic
1069860419 10:71467810-71467832 CTGCGCAGAGGAGCAAACTGAGG + Intronic
1071574702 10:86716671-86716693 CTGGCAAGTGGTGGCACCTGAGG - Exonic
1073322195 10:102622120-102622142 CTGGCCAAAGGTGGGAACTGGGG + Intronic
1075145956 10:119883211-119883233 CTAGCCAGAGGGGCAGACTGTGG + Intronic
1075411787 10:122233812-122233834 GTTGCCAGTGGTGCCACCTGTGG + Intronic
1076498470 10:130915256-130915278 CTGGCCTGTGGGGCAGGCTGGGG - Intergenic
1076850665 10:133090972-133090994 CTGTCCAGTGGTTAAAGCTGGGG + Intronic
1077917725 11:6622143-6622165 CTGGCCAGTGGTTGGAACTGAGG + Exonic
1079682168 11:23311416-23311438 GAGGGCAGTGGTGCAAACTCAGG + Intergenic
1080679916 11:34464938-34464960 AAGGCCAATGGTGCAACCTGGGG - Intronic
1082693463 11:56332126-56332148 CTGGCCAGCGGTGCCAGGTGAGG + Intergenic
1084356259 11:68640814-68640836 TTGGACAGTGATGCCAACTGAGG - Intergenic
1084466830 11:69328190-69328212 CTGCCCAGTGGAGGAAACTGAGG + Intronic
1086205413 11:84252201-84252223 GTGTGCAGTGGTGCAAACTCGGG + Intronic
1086533058 11:87809406-87809428 CTTGCCAGGGCTGCAACCTGTGG + Intergenic
1087135270 11:94710215-94710237 CTGCCCAGAGGTGCCACCTGAGG + Intronic
1087220651 11:95543069-95543091 CTGGCTAGTGGTGCTATCTGAGG + Intergenic
1088664909 11:112084970-112084992 ATGGCCAGTAGTGCAAATGGGGG - Exonic
1089026418 11:115275110-115275132 CTGGGCAGTGGCGCAATGTGGGG - Intronic
1089677686 11:120100842-120100864 CAGGCCACTGGAGCACACTGTGG + Intergenic
1094064978 12:26352377-26352399 CTGGCCAGAGGTCCCACCTGGGG - Intronic
1094720361 12:33056517-33056539 CTGACCAAAGGGGCAAACTGTGG - Intergenic
1095947145 12:47759663-47759685 TTGCACAGTGGTGGAAACTGAGG - Intronic
1098511197 12:71315822-71315844 CTGGGCAGTGGCGCAATCTCTGG + Intronic
1100241114 12:92711325-92711347 GAGGCCATTGGTGCAGACTGGGG + Intergenic
1101523198 12:105503980-105504002 CTGGCCAGTGGGAGATACTGGGG - Intergenic
1103908791 12:124340585-124340607 CTGGGCAGTGGCGCTACCTGGGG + Exonic
1104958383 12:132476828-132476850 CTGGACAGTGATGGAAGCTGGGG - Intergenic
1107528267 13:41255914-41255936 GTGGCCATTGCTGCAAATTGAGG + Intronic
1109578897 13:64299830-64299852 GTGGTCATAGGTGCAAACTGGGG - Intergenic
1109851819 13:68075577-68075599 CTGGCCAGCTGTCCAAGCTGTGG + Intergenic
1111990805 13:95115091-95115113 CTTGTCAGTGGTTCAAGCTGGGG - Intronic
1112158867 13:96848169-96848191 CAGGCCAGAGGTGCAAGCTGTGG + Intergenic
1114360064 14:21961869-21961891 CTGGCCAGTGGGGAGAAGTGAGG - Intergenic
1114402343 14:22421456-22421478 ATGGGCAGTTGTGCAAAGTGAGG + Intergenic
1114653046 14:24298990-24299012 GCGGCCAGTGATGTAAACTGTGG + Exonic
1121265977 14:92602928-92602950 CTGTCCAGGGCTGCAACCTGGGG + Intronic
1121494866 14:94385265-94385287 CTCCCCAGTTGTGCAAAGTGGGG + Intronic
1121966486 14:98311608-98311630 CTCGCCAGTTGTGTAAACTTGGG - Intergenic
1202899615 14_GL000194v1_random:27703-27725 CTGGCCCGAGGTGCACCCTGGGG + Intergenic
1123474059 15:20576381-20576403 CAGGACAGTGGGGCTAACTGTGG + Intergenic
1123643951 15:22423972-22423994 CAGGACAGTGGGGCTAACTGTGG - Intergenic
1123734360 15:23171393-23171415 CAGGACAGTGGGGCTAACTGTGG + Intergenic
1124284866 15:28392701-28392723 CAGGACAGTGGGGCTAACTGTGG + Intergenic
1124297831 15:28518913-28518935 CAGGACAGTGGGGCTAACTGTGG - Intergenic
1124483467 15:30097358-30097380 CAGGACAGTGGGGCTAACTGTGG + Intergenic
1124520111 15:30399868-30399890 CAGGACAGTGGGGCTAACTGTGG - Intergenic
1124538544 15:30566356-30566378 CAGGACAGTGGGGCTAACTGTGG + Intergenic
1124760107 15:32441226-32441248 CAGGACAGTGGGGCTAACTGTGG - Intergenic
1124975355 15:34524609-34524631 CAGGACAGTGGGGCTAACTGTGG - Intergenic
1125492382 15:40157969-40157991 CTGGGTCTTGGTGCAAACTGTGG - Intergenic
1126683516 15:51226666-51226688 CTTGTCAGTGGTGGAATCTGGGG - Intronic
1126997566 15:54462537-54462559 CTGGCCAGTTGCTCAAAGTGTGG - Intronic
1127288527 15:57550877-57550899 CTGGTCAGTGGTGAATGCTGAGG + Intergenic
1127969322 15:63946218-63946240 CTGGCCAGAGGTGCCTGCTGTGG + Intronic
1128810357 15:70566887-70566909 CAGGGCTGTTGTGCAAACTGGGG - Intergenic
1130144524 15:81263763-81263785 GTGGCCAGTGGTGCATGCTTTGG - Intronic
1131733408 15:95306025-95306047 CTGGCCATTGGTGCCTAATGTGG - Intergenic
1132184999 15:99796657-99796679 CGGGACAGTGGGGCTAACTGTGG + Intergenic
1132431989 15:101767897-101767919 CGGGACAGTGGGGCTAACTGTGG - Intergenic
1132955940 16:2593589-2593611 CTGGCGTGTGGTGAAAGCTGAGG + Intronic
1136356019 16:29745278-29745300 GAGGACAGTGGTGCAATCTGGGG - Intronic
1137271609 16:46906046-46906068 CTGGCCAGTGGTGCTAATGTGGG + Intronic
1137576817 16:49605353-49605375 CTGGCCAGCTGTGCAACCTCGGG + Intronic
1138237530 16:55397576-55397598 CTGGCCAGTGGGGCAACATGAGG - Intronic
1138553268 16:57758553-57758575 CTGGCCAGCTCTGCAAGCTGAGG + Exonic
1140473925 16:75229267-75229289 CGGGCCCGTGGTGCATGCTGGGG + Exonic
1147448090 17:40487260-40487282 TTGGCCAGTGGTGGAGAGTGGGG + Exonic
1152119915 17:78412127-78412149 CTGGCCTGTGGGGCATGCTGGGG + Intronic
1153265407 18:3263836-3263858 CTGGCTAGTGGTTCAAGCTCTGG + Intronic
1157251565 18:46100198-46100220 GAGGACAGTGGTGCAATCTGGGG - Intronic
1158366319 18:56741080-56741102 CTACCTAGTGGTGCAAACTGTGG + Intronic
1161681354 19:5681240-5681262 CTGGACAGTGGGGGAAACTGAGG + Exonic
1161753436 19:6114142-6114164 CTGGCCAGAGGCGGAAACTGTGG + Intronic
1161936638 19:7376369-7376391 CTGGCCATTGTTGGAAGCTGTGG + Intronic
1162360527 19:10217337-10217359 CTGGCCAGTCGGCCACACTGTGG + Intronic
1165560833 19:36678222-36678244 GTGGCCAGTGGAGAGAACTGAGG + Intergenic
1167746209 19:51353250-51353272 CTGGCCATGGGTGCAGACCGAGG - Exonic
926246189 2:11123710-11123732 CAGGCCAGGGGTGCAAATTGAGG + Intergenic
926465605 2:13182476-13182498 CTGGGCAGAGGTGCAAACTGTGG + Intergenic
927201148 2:20578754-20578776 CTGGACAGGGGAGGAAACTGAGG + Intronic
928240267 2:29580008-29580030 TTGGGCAGTGGTTGAAACTGGGG - Intronic
929569085 2:43008644-43008666 CTGGGCAGTGGGCCAAACTGTGG + Intergenic
929628087 2:43431041-43431063 TTGGTCAGTGGTGCAGCCTGAGG - Intronic
929947070 2:46379833-46379855 TAGGCCTGTGGTGCACACTGTGG - Intronic
931174091 2:59835459-59835481 CTGGGCACAGGTGCAAGCTGGGG - Intergenic
931440873 2:62289447-62289469 CTGGGCTGTGGTGCAACGTGTGG + Intergenic
934757962 2:96838111-96838133 CTGACCAGTGCTGCACACTAGGG - Exonic
935571998 2:104671436-104671458 CTGGCTAGAGGTGCAGAGTGGGG + Intergenic
936263209 2:110979777-110979799 ATGGGCAGTGGTGCAAACGGAGG + Intronic
936786447 2:116099180-116099202 CTGGATGGTGGTGCTAACTGAGG - Intergenic
942943435 2:181646565-181646587 CTGGTCAGTATTGCACACTGTGG - Intronic
943520651 2:188944759-188944781 CTGGCCTGTGGTGCCAACGCCGG + Intergenic
946866926 2:224049174-224049196 CTGGCCAGTCCTGTAAAATGAGG - Intergenic
1171230295 20:23479043-23479065 CTGGCCTGGGGAGCAAAGTGAGG - Intergenic
1173587301 20:44192501-44192523 CAGGAGAGTGGTGCAACCTGGGG - Intergenic
1174520165 20:51123277-51123299 CTGGCCGGTGGTGGGAAGTGTGG - Intergenic
1175220204 20:57412330-57412352 CTTTCCAGTTGAGCAAACTGAGG + Intergenic
1175385122 20:58589898-58589920 CTGCCCAGAGCTGTAAACTGTGG + Intergenic
1176221255 20:63970155-63970177 TTGGACAGTGGGGTAAACTGAGG + Intronic
1176618991 21:9042477-9042499 CTGGCCCGAGGTGCACCCTGGGG + Intergenic
1176697483 21:9997505-9997527 CTGCCCTGTGTTGTAAACTGGGG - Intergenic
1177664464 21:24136146-24136168 CTAGGGAGTGGGGCAAACTGGGG - Intergenic
1179297768 21:40078823-40078845 CTGAGCTGTGGTCCAAACTGTGG + Exonic
1179896763 21:44367475-44367497 CTCACCAGTGGTGCAACCTTGGG - Intronic
1180100147 21:45580055-45580077 TTGGCCACTCGTGCAAACTCTGG + Intergenic
1180986075 22:19904558-19904580 CTGGCGAGTGGTGCCCACAGTGG - Intronic
1182567343 22:31210261-31210283 ATGGCCAGTGAAACAAACTGTGG + Intergenic
1183084295 22:35477156-35477178 CTGGACAGAGGAGGAAACTGAGG + Intergenic
1183673531 22:39287162-39287184 CTGGCCATTGGTGCAGATGGGGG - Intergenic
951970720 3:28441587-28441609 GAGGCCATTGGTGCAAGCTGGGG + Intronic
952269158 3:31815528-31815550 GTGGCCAGTTATGGAAACTGTGG + Intronic
953550238 3:43896645-43896667 CTGGCCAATGGTGTAAAATTAGG - Intergenic
953687138 3:45086863-45086885 CTGACCAGTGATGCAAATGGAGG + Intronic
953981209 3:47414074-47414096 CTGGGCTGTGGTGCAAGCTTGGG - Exonic
955696026 3:61637703-61637725 CTCACCAGTGTTGCCAACTGTGG + Intronic
956173228 3:66449585-66449607 CAGGCCCGTGGGGCAAACTGGGG + Intronic
957378247 3:79388885-79388907 CTGGCCTTTGGTTCTAACTGTGG - Intronic
957409737 3:79824295-79824317 CGGGCCAGTGGTGGCAGCTGAGG + Intergenic
964474552 3:157086977-157086999 CAGGCCAGTGAAGGAAACTGGGG + Intergenic
969974437 4:11083844-11083866 CTGGCAAGTGCTGAAAACGGAGG - Intergenic
970332538 4:15001965-15001987 CTGGCCCGCGGGGGAAACTGAGG - Intergenic
973139239 4:46745586-46745608 CTGGCCAGAGGGGCAAACTTTGG + Intronic
975217909 4:71778460-71778482 ATGCTCAGTGGTGAAAACTGAGG + Intronic
977959783 4:103072476-103072498 CTGGCAAGTGGAGCATACTTTGG + Intronic
979124756 4:116955348-116955370 CTGGTCACTGGCCCAAACTGAGG + Intergenic
980451791 4:132983058-132983080 CTGGCCAGTGGATCAAATTTTGG + Intergenic
982207520 4:153007932-153007954 CTGTCCAGATGTGGAAACTGAGG - Intergenic
987830287 5:23086729-23086751 ATGACCATTGGTGCAACCTGAGG + Intergenic
988612923 5:32745028-32745050 CTCTACAGTGGTGGAAACTGAGG + Intronic
988643719 5:33070149-33070171 ATGGCCAGTGTTGCAAATGGGGG + Intergenic
993285544 5:85991374-85991396 CAGGCCCGTGGTGCAAGCAGTGG - Intergenic
994000464 5:94773265-94773287 CATGCCAGGGGTGTAAACTGAGG - Intronic
994873971 5:105392091-105392113 CGGGCCAGTAGTACAAACTGAGG - Intergenic
996160360 5:120154623-120154645 ATGACCAGAGGGGCAAACTGTGG - Intergenic
996802521 5:127419740-127419762 ATGGGCAGTGATGCACACTGTGG - Intronic
1001173635 5:169444925-169444947 CAGGCCACTGGTGCAGGCTGGGG - Intergenic
1001629465 5:173164015-173164037 CAGGCAACTGGTGCAAACGGAGG - Exonic
1001761607 5:174212301-174212323 CTGGCCAGTGCTCCACACTGAGG + Intronic
1005836551 6:29713840-29713862 CTGGAGAGTGGTGCTGACTGAGG - Intergenic
1006443023 6:34063731-34063753 CCGGCCAGTGGTGCAGCCAGTGG - Intronic
1006454298 6:34123150-34123172 CTTGCCAGTGAAGCAACCTGTGG - Intronic
1006800637 6:36757510-36757532 CGGGCCAGTGGTGCATACATTGG + Intronic
1007112182 6:39319345-39319367 CTGGCCAGTGGAACAGACAGTGG - Intronic
1007815844 6:44525122-44525144 CTGCCCAGAGGTGCACAATGTGG + Intergenic
1008525654 6:52404281-52404303 CTGGCAAGTGGGGCAACGTGTGG + Exonic
1013248683 6:108313074-108313096 CTGGCCAGTGATGCCTAATGGGG - Intronic
1014013181 6:116500194-116500216 CTGGCCAGGGCTGCAACCTCTGG - Intronic
1016287190 6:142486392-142486414 CTTACCAGTTGTGCAATCTGAGG + Intergenic
1024061088 7:45699253-45699275 CTGGCCTCTGGAGCACACTGAGG + Intronic
1024346634 7:48321079-48321101 GAGGCCAGTGGTTCAAACCGGGG + Intronic
1030686882 7:112496211-112496233 GTAGACAGTGGTGAAAACTGTGG + Intergenic
1032129077 7:129214295-129214317 CTGGCCAGGGGAGGAAGCTGTGG - Intergenic
1032794011 7:135263269-135263291 TGGGCCAGTAGTGCAAGCTGAGG - Intergenic
1034276574 7:149826444-149826466 CTGGCCAGGGGGGCACTCTGTGG - Intergenic
1034556655 7:151854638-151854660 CAGCCCAATTGTGCAAACTGAGG - Intronic
1035101648 7:156402384-156402406 CTGGCCGGTGGATGAAACTGCGG - Intergenic
1037670701 8:21012976-21012998 CTCCCCAGTGATGCAAACTCTGG + Intergenic
1042530704 8:69811865-69811887 CTGGCCAGTGGTGCAAACTGGGG - Intronic
1043522680 8:81063416-81063438 GTGGCCAGAGGTGCTCACTGAGG - Intronic
1045400927 8:101817103-101817125 CTGGCCAGAAGTGCAAAGAGAGG - Intronic
1050137360 9:2480460-2480482 CCAGCCAGTTGTGCAAACTCAGG + Intergenic
1053016650 9:34665796-34665818 CTGTCCCGTGGTGGCAACTGAGG - Exonic
1053418480 9:37961798-37961820 CAGGACAGTGGTGCAGACTTTGG - Intronic
1053483274 9:38432363-38432385 CTGGCCTGTGCTGGACACTGGGG + Intergenic
1053634603 9:39983867-39983889 CTGCCCTGTGTTGTAAACTGGGG - Intergenic
1053771325 9:41480466-41480488 CTGCCCTGTGTTGTAAACTGGGG + Intergenic
1053901086 9:42796099-42796121 CTGTCTAGTTGTGGAAACTGTGG + Intergenic
1054209284 9:62266830-62266852 CTGCCCTGTGTTGTAAACTGGGG + Intergenic
1054260560 9:62861465-62861487 CTGTCTAGTTGTGGAAACTGTGG - Intergenic
1054315531 9:63581300-63581322 CTGCCCTGTGTTGTAAACTGGGG - Intergenic
1062085517 9:134646072-134646094 CTGGGAAGTGGTGGAGACTGTGG - Intronic
1186846455 X:13535529-13535551 CAGGCCAGGGCTGCAAACTGTGG + Intergenic
1189063347 X:37778657-37778679 CTGTCCAGTGGGGCAAAATGTGG - Intronic
1189305597 X:39984587-39984609 CTCGCTAGTGGTTCAACCTGTGG - Intergenic
1192469861 X:71388610-71388632 TTGGCCAGTCATGCCAACTGTGG + Intronic
1193308222 X:79974774-79974796 CTTGCCTGTCGTGCAAGCTGAGG - Intergenic
1193447186 X:81619047-81619069 GAGGCCATTGGTGCAAGCTGGGG - Intergenic
1195525910 X:105889569-105889591 CTGGCCACTGCAGCAAACTTCGG + Intronic
1197181506 X:123541842-123541864 CTTGCCACAGGTGCACACTGAGG + Intergenic
1197591901 X:128419662-128419684 GAGGCCATTGGTGCAGACTGGGG - Intergenic
1197710916 X:129666561-129666583 CAGGTCAGTGGAGGAAACTGGGG - Intergenic
1200074985 X:153546429-153546451 CTGGCCAGATGAGAAAACTGAGG + Intronic
1201416779 Y:13754969-13754991 CTGGGCAGTGGAGAAAAGTGGGG - Intergenic
1202060985 Y:20887609-20887631 CTGTCCAGGGGTGAGAACTGGGG + Intergenic