ID: 1042538274

View in Genome Browser
Species Human (GRCh38)
Location 8:69881242-69881264
Sequence GTTGATTTTCTTGAAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042538274_1042538276 0 Left 1042538274 8:69881242-69881264 CCTATCTTTTCAAGAAAATCAAC No data
Right 1042538276 8:69881265-69881287 ATTTCATCCCCAACTGATGGTGG No data
1042538274_1042538275 -3 Left 1042538274 8:69881242-69881264 CCTATCTTTTCAAGAAAATCAAC No data
Right 1042538275 8:69881262-69881284 AACATTTCATCCCCAACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042538274 Original CRISPR GTTGATTTTCTTGAAAAGAT AGG (reversed) Intergenic
No off target data available for this crispr