ID: 1042545900

View in Genome Browser
Species Human (GRCh38)
Location 8:69951081-69951103
Sequence CCGGGTCTGCATTTTTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042545900_1042545903 -10 Left 1042545900 8:69951081-69951103 CCTTCCAAAAAATGCAGACCCGG No data
Right 1042545903 8:69951094-69951116 GCAGACCCGGTACTGAGCACAGG No data
1042545900_1042545906 7 Left 1042545900 8:69951081-69951103 CCTTCCAAAAAATGCAGACCCGG No data
Right 1042545906 8:69951111-69951133 CACAGGATTCCTGCGATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042545900 Original CRISPR CCGGGTCTGCATTTTTTGGA AGG (reversed) Intergenic