ID: 1042545903

View in Genome Browser
Species Human (GRCh38)
Location 8:69951094-69951116
Sequence GCAGACCCGGTACTGAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042545897_1042545903 26 Left 1042545897 8:69951045-69951067 CCCATCTCCAACACACTCTAATG No data
Right 1042545903 8:69951094-69951116 GCAGACCCGGTACTGAGCACAGG No data
1042545900_1042545903 -10 Left 1042545900 8:69951081-69951103 CCTTCCAAAAAATGCAGACCCGG No data
Right 1042545903 8:69951094-69951116 GCAGACCCGGTACTGAGCACAGG No data
1042545899_1042545903 19 Left 1042545899 8:69951052-69951074 CCAACACACTCTAATGAGCTCAT No data
Right 1042545903 8:69951094-69951116 GCAGACCCGGTACTGAGCACAGG No data
1042545898_1042545903 25 Left 1042545898 8:69951046-69951068 CCATCTCCAACACACTCTAATGA No data
Right 1042545903 8:69951094-69951116 GCAGACCCGGTACTGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042545903 Original CRISPR GCAGACCCGGTACTGAGCAC AGG Intergenic