ID: 1042545906

View in Genome Browser
Species Human (GRCh38)
Location 8:69951111-69951133
Sequence CACAGGATTCCTGCGATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042545902_1042545906 3 Left 1042545902 8:69951085-69951107 CCAAAAAATGCAGACCCGGTACT No data
Right 1042545906 8:69951111-69951133 CACAGGATTCCTGCGATGCATGG No data
1042545900_1042545906 7 Left 1042545900 8:69951081-69951103 CCTTCCAAAAAATGCAGACCCGG No data
Right 1042545906 8:69951111-69951133 CACAGGATTCCTGCGATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042545906 Original CRISPR CACAGGATTCCTGCGATGCA TGG Intergenic