ID: 1042554854

View in Genome Browser
Species Human (GRCh38)
Location 8:70025441-70025463
Sequence CAGAATCCCCAAGAGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042554854_1042554857 -4 Left 1042554854 8:70025441-70025463 CCCTGCCTCTCTTGGGGATTCTG No data
Right 1042554857 8:70025460-70025482 TCTGCTACAGCATTTGTTCTAGG No data
1042554854_1042554858 6 Left 1042554854 8:70025441-70025463 CCCTGCCTCTCTTGGGGATTCTG No data
Right 1042554858 8:70025470-70025492 CATTTGTTCTAGGACATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042554854 Original CRISPR CAGAATCCCCAAGAGAGGCA GGG (reversed) Intergenic
No off target data available for this crispr