ID: 1042559332

View in Genome Browser
Species Human (GRCh38)
Location 8:70061204-70061226
Sequence CTCTGCAGGGATGCTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042559332_1042559338 6 Left 1042559332 8:70061204-70061226 CCTACAAAAGCATCCCTGCAGAG 0: 1
1: 0
2: 0
3: 18
4: 183
Right 1042559338 8:70061233-70061255 CTGGATCCCAGAGGATAAAGTGG No data
1042559332_1042559337 -3 Left 1042559332 8:70061204-70061226 CCTACAAAAGCATCCCTGCAGAG 0: 1
1: 0
2: 0
3: 18
4: 183
Right 1042559337 8:70061224-70061246 GAGGACACTCTGGATCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042559332 Original CRISPR CTCTGCAGGGATGCTTTTGT AGG (reversed) Intronic
902234550 1:15049095-15049117 CTTTGCCGGGAGGCTTTTGACGG + Intronic
902810592 1:18885780-18885802 CTCTGATGGGACGCTGTTGTTGG - Intronic
903000668 1:20263265-20263287 TTCTGTTGGGATGCTTTTGGTGG + Intergenic
908092255 1:60698652-60698674 CTCTGCAGGGCTACTTTTATTGG + Intergenic
910042702 1:82872504-82872526 ATCTGATGGGTTGCTTTTGTGGG + Intergenic
913437211 1:118859568-118859590 TTCTGCAGGGAGGATTTTGTAGG - Intergenic
914340830 1:146758860-146758882 CTCTGCAGGTGTGTTTGTGTAGG - Intergenic
915655930 1:157360409-157360431 CTCAGCAGGGATGCTGTGGAGGG - Intergenic
915673401 1:157509492-157509514 CTCAGCAGGGATGCTGTGGAGGG + Intergenic
916726586 1:167528903-167528925 TAATGCAGGGATGTTTTTGTAGG + Intergenic
917976910 1:180245541-180245563 CTCTGCAGGGATTCTTATGAGGG + Intronic
920763426 1:208808022-208808044 TGCTGCAGGGATGCTATTGTAGG - Intergenic
922165393 1:223111533-223111555 CTCTGTTGGGATGTTTTTGAGGG - Exonic
922729163 1:227941023-227941045 CTCTGCATGGCTGCTCTGGTGGG + Intronic
1063479802 10:6365423-6365445 TTCTCCAGGGGTGCTTTTTTAGG + Intergenic
1063569472 10:7201523-7201545 CTCTGTAGGTATTTTTTTGTGGG - Intronic
1063678281 10:8161504-8161526 CTCTGCAGTGATACCTTTCTCGG - Intergenic
1068203697 10:53818864-53818886 TTCTACAGAGATTCTTTTGTTGG - Intronic
1068961412 10:62870188-62870210 CTCACCAGTGATGCTATTGTTGG - Intronic
1070424272 10:76270283-76270305 GTCTTCAGGGAAGCCTTTGTTGG - Intronic
1071112213 10:82172859-82172881 CTATGATGGGTTGCTTTTGTTGG - Intronic
1074008559 10:109454033-109454055 TTTTGCAGAGATTCTTTTGTAGG - Intergenic
1074113773 10:110440668-110440690 CTCCTCAGGGAAGCTTTTCTAGG - Intergenic
1074492605 10:113952483-113952505 CCCTGTAGGGATGTTTTTGGAGG + Intergenic
1075420408 10:122296327-122296349 CTCTCCAGGGATGTGGTTGTTGG + Intronic
1075786808 10:125055553-125055575 CTCTGCAGTGCTGCTTCTGGGGG - Intronic
1077628625 11:3795760-3795782 CTCTTCTGGGAAGCTTTTCTTGG - Intronic
1080091582 11:28355055-28355077 CTCTGTGGGAGTGCTTTTGTGGG - Intergenic
1081379112 11:42393345-42393367 CTCTGGATGGAAGCTGTTGTGGG + Intergenic
1081523799 11:43909274-43909296 CTCTGCAAAGATGACTTTGTGGG + Intronic
1083985091 11:66209203-66209225 CTCTTCTTGGATGCTTTTTTTGG - Intronic
1084047314 11:66576724-66576746 CTCAGCAGGGGAGCTTTTGCTGG - Intergenic
1084144685 11:67258664-67258686 CTCTGCAGGGCTGCTCTTTTTGG - Intergenic
1084294592 11:68203538-68203560 CTTTGCAGGGCTTCTTTTATTGG - Intronic
1084677956 11:70647699-70647721 CTCAGCAGTTAAGCTTTTGTTGG + Intronic
1087064242 11:94012106-94012128 CTCTGTAGGGATGCTGGTTTTGG + Intergenic
1088324947 11:108592358-108592380 CCCTGGAGGGTTTCTTTTGTCGG + Intronic
1089475731 11:118760132-118760154 CATTTCATGGATGCTTTTGTTGG - Intronic
1089876030 11:121722930-121722952 CTCTCCCGGGATGCTGTCGTGGG + Intergenic
1093633009 12:21432229-21432251 CTCTGCTGGGGTGCTTTTATGGG - Intergenic
1094389141 12:29930023-29930045 CTATTCAGGGATGCTTTGTTTGG - Intergenic
1095499712 12:42823566-42823588 CTTTGTGGGCATGCTTTTGTGGG + Intergenic
1096429434 12:51531076-51531098 CTCTGAAGGGATGCATTTTGAGG + Intergenic
1098118743 12:67211479-67211501 CCCTGCAGGGGTACTTTTTTTGG - Intergenic
1100967936 12:100033405-100033427 CTCACCAGGAATTCTTTTGTGGG - Intronic
1101985168 12:109440378-109440400 CTCTTGAGGGATGCTATTCTAGG - Intronic
1102222098 12:111201531-111201553 CTCTCCAGGTGTGCTTTTCTTGG + Intronic
1102814125 12:115849188-115849210 GTCTGCAGATATGCTTTTGGTGG - Intergenic
1104646044 12:130498044-130498066 CTCTGCAGAGGTGCTTCTCTGGG - Intronic
1104656293 12:130576077-130576099 CTCTGCAGGGAGGCTGGTGCGGG + Intronic
1104873775 12:132018771-132018793 TTCTGAAGTGATGCTTTTGCGGG + Intronic
1105596155 13:21841239-21841261 CTTTCCAGGGATGCTTATCTGGG + Intergenic
1106455886 13:29926240-29926262 CTCTGCATGTGTGTTTTTGTGGG - Intergenic
1108438248 13:50422567-50422589 CTCTGCAGGGAACATTCTGTGGG + Intronic
1111803471 13:93008233-93008255 CTCTTCTGGTATGTTTTTGTAGG - Intergenic
1113325281 13:109275620-109275642 CACTTCAGGGATGCATTTGGTGG + Intergenic
1114060941 14:19015418-19015440 CTCTGCAGGGGTGCGTCTGGAGG + Intergenic
1114081031 14:19201489-19201511 TTCTGCAGGGGTGCTGCTGTAGG + Intergenic
1114101315 14:19384561-19384583 CTCTGCAGGGGTGCGTCTGGAGG - Intergenic
1114186385 14:20405633-20405655 GTCTGCATGGATGCTTAAGTTGG - Intronic
1120819092 14:88895356-88895378 ACCTGCTGGGAGGCTTTTGTGGG + Intergenic
1121684010 14:95818607-95818629 AACTGCAGGGCTGCTCTTGTTGG + Intergenic
1122935827 14:104955678-104955700 CCCAGCAGGGATGCTTATGGTGG - Intronic
1125152401 15:36547621-36547643 CTTTGCAGGGAATCTTTTGAAGG + Intergenic
1125364141 15:38895953-38895975 CTTTGAAAGGATGTTTTTGTAGG - Intergenic
1126709592 15:51442344-51442366 CTTTGCAGGCTTGCTTTGGTTGG + Intergenic
1127664844 15:61135659-61135681 CCCTGCAGAGCTGCTTTTGCCGG + Intronic
1130445202 15:83994538-83994560 CTCTGGAAGGATGTTTTTGTTGG + Intronic
1133404401 16:5511357-5511379 CTCTGCAGGGATGGTGGTGGGGG + Intergenic
1139993453 16:70958546-70958568 CTCTGCAGGTGTGTTTGTGTAGG + Intronic
1140351875 16:74270280-74270302 GTCTGCAGGGAAGCTCTTTTGGG - Intergenic
1142920730 17:3182997-3183019 CTCAGCAGGGAGGCTTTGGCAGG - Intergenic
1144030674 17:11319495-11319517 ATCTTCAGGGATTCTTTAGTTGG + Intronic
1144117844 17:12117478-12117500 CTTTGTAGGCATGCTTATGTGGG - Intronic
1145305301 17:21670930-21670952 CTCTGCAGGGGGCATTTTGTAGG - Intergenic
1149989937 17:61377342-61377364 CTCGGCAGGGGTGGTGTTGTTGG + Intronic
1151178067 17:72305421-72305443 CTCTGAATGGATTCTTTTCTGGG + Intergenic
1151885453 17:76920837-76920859 CTCTCCAGAGAGGCTTTTCTTGG + Intronic
1152895496 17:82908662-82908684 CTCTGCAGCCATGCTTGTCTCGG - Intronic
1153642416 18:7168135-7168157 GTCTGGAGGGCTGCTCTTGTGGG - Intergenic
1155178208 18:23320068-23320090 ATTTGAAGGGATGCTTTTGCTGG - Intronic
1157164440 18:45345465-45345487 CTTTGTAGGGAAGCTTTTGCAGG - Intronic
1158639687 18:59193224-59193246 CTCTACGGGACTGCTTTTGTAGG + Intergenic
1159026234 18:63184304-63184326 CTCTGCAGGGAAGTTTTCCTAGG - Intronic
1159657919 18:71055106-71055128 CTCTGCTGGGATACTTCTGAGGG + Intergenic
1160816647 19:1039103-1039125 CTTTGCTTTGATGCTTTTGTGGG + Intergenic
1160978067 19:1803517-1803539 CTGAGCAAGGAGGCTTTTGTGGG - Intronic
1161597030 19:5155839-5155861 CTCTTCAGGTCTGCTGTTGTCGG - Intergenic
1162320353 19:9967999-9968021 GTATGCAGGGAATCTTTTGTGGG - Intronic
1163256802 19:16160873-16160895 CTCTGCAGGGATGTTATAGGGGG + Intergenic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
1164510963 19:28896939-28896961 CTCAGCTGGGAAGCATTTGTTGG - Intergenic
1164849799 19:31472069-31472091 CTCTTGAGGGCTGCTTTTGTGGG - Intergenic
1165670894 19:37678067-37678089 CACTGCCAGGATCCTTTTGTAGG - Intronic
1166119204 19:40674844-40674866 GTGTCCAGGCATGCTTTTGTTGG - Intronic
925785659 2:7429786-7429808 CTCTCTTGGGATGCTTTTGTGGG - Intergenic
926381821 2:12298575-12298597 CTCTAGAGTGATGTTTTTGTTGG + Intergenic
927282137 2:21318131-21318153 CTCTCCCAGGTTGCTTTTGTGGG - Intergenic
927416894 2:22889426-22889448 CTAGGCAGGGCTGCCTTTGTGGG - Intergenic
927747935 2:25639816-25639838 CTCTTCCGGGATGCTTGTGCTGG + Intronic
930763997 2:55065365-55065387 CTATGAAGGGCTGCCTTTGTAGG + Intronic
934928647 2:98401019-98401041 TTCTGCAGGGATCAATTTGTGGG + Intergenic
937097208 2:119243110-119243132 CTCTGAGGGGTTGCTTTTGTGGG - Intronic
937462434 2:122101170-122101192 CTCTGCAGGGACCCTTCTCTGGG - Intergenic
940298550 2:152155375-152155397 CTCAGCAGTGAAGCTTTGGTTGG - Intronic
941440861 2:165533707-165533729 CTATTCAAGGATGCTTTGGTAGG + Intronic
942121660 2:172783704-172783726 CTCTGTAGGCATGTTTATGTGGG + Intronic
943664350 2:190593210-190593232 CTCTGCTTAGATGCTTCTGTTGG + Intergenic
946660836 2:221997758-221997780 CTCTGCATCCATGCTTCTGTTGG + Intergenic
948287065 2:236793975-236793997 CTTTGCAGAGAGGCTTTTATGGG - Intergenic
1169772695 20:9219073-9219095 CTCTGCTGGGGTTCTTTTTTTGG - Intronic
1169995094 20:11547231-11547253 CTCTGTATGAATGCTGTTGTGGG + Intergenic
1170578246 20:17680801-17680823 TTCAGTTGGGATGCTTTTGTTGG - Intronic
1170680618 20:18522252-18522274 CTCTGCAGGGATGCCTGCCTTGG - Intronic
1171138803 20:22723066-22723088 CACTGCTGGGATGCTTCTGATGG + Intergenic
1171440884 20:25161996-25162018 AGCTCCAGTGATGCTTTTGTTGG + Intergenic
1171530558 20:25850372-25850394 CTCTGCAGGGGGCATTTTGTAGG - Intronic
1178353251 21:31888306-31888328 CGTTACTGGGATGCTTTTGTTGG + Intronic
1178715194 21:34957984-34958006 CTTTACAAGGATGCATTTGTTGG - Intronic
1179204189 21:39258848-39258870 CTCTACAGGAAGACTTTTGTTGG - Intronic
1180479424 22:15738030-15738052 CTCTGCAGGGGTGCGTCTGGAGG + Intergenic
1180499742 22:15921196-15921218 TTCTGCAGGGGTGCTGCTGTAGG - Intergenic
1183364877 22:37401622-37401644 CTGTGCAGGGATGGTTTGTTTGG - Intronic
950155686 3:10719949-10719971 AGCAGCAGGGATGCTTTTCTGGG + Intergenic
950426008 3:12925054-12925076 GGCTGCAGGGGTGCTTCTGTGGG + Intronic
950661847 3:14471670-14471692 CTCTTCAGGGGTGCATTTGTGGG - Intronic
951379211 3:21962360-21962382 CTCTGCAGAGATGTCTTTGCAGG - Intronic
955367378 3:58322475-58322497 CTTTGCAGGGCTGCTTCTTTTGG + Intergenic
959807588 3:110575732-110575754 CACTTCAGAGATGTTTTTGTTGG - Intergenic
962009911 3:131382378-131382400 TTCTCCAGGGATGCTTTCTTGGG - Exonic
966760396 3:183412967-183412989 CTCTACTGAGATGCTTATGTGGG + Intronic
971538850 4:27789675-27789697 CTCTGCAGCATTGCTTCTGTGGG - Intergenic
972366736 4:38382883-38382905 CTCAGCAGCAATGCTTTTGGGGG - Intergenic
975510338 4:75187803-75187825 CTCTCCAGGGAAATTTTTGTAGG - Intergenic
975700461 4:77061091-77061113 CTATGCAGGAATGCTTTTCTTGG - Intronic
975726221 4:77294286-77294308 CTCTGCAGTCATGGGTTTGTGGG - Intronic
976564390 4:86537108-86537130 CCCTGCAGGGCTACTGTTGTTGG - Intronic
976875064 4:89843291-89843313 ATGTGCAGGGTTGCTTTTTTTGG + Intergenic
979140545 4:117167926-117167948 ATTTTCAGGGATGCTTCTGTTGG - Intergenic
979219691 4:118208391-118208413 CTCTGCAGAGATGCCTTTCTAGG + Intronic
979427286 4:120583549-120583571 TTCTGCAGGGATCCTTCTGGTGG + Intergenic
981652226 4:147073091-147073113 ATTTGCAGCCATGCTTTTGTGGG - Intergenic
984458520 4:180002423-180002445 TTCTTCAGGGATGGGTTTGTGGG - Intergenic
985271717 4:188199695-188199717 TTCTGCAGGGCTGATTTTGTGGG - Intergenic
990325379 5:54670504-54670526 CCCTGCAGTGATGTTTGTGTTGG + Intergenic
991388344 5:66115184-66115206 CTCTGCAGAGATGGGTATGTGGG - Intergenic
991541435 5:67733912-67733934 CTGTGAAGGGATCCTGTTGTGGG + Intergenic
994703352 5:103166290-103166312 CTCTGTAGTGAAGATTTTGTGGG - Intronic
997792763 5:136776689-136776711 CTCTGCTGGGCCTCTTTTGTTGG + Intergenic
998210980 5:140198066-140198088 ATCTGCAGGTATGCTCTTCTGGG - Intronic
998298346 5:140993563-140993585 CTTTCTAGGGATGCTTTTCTTGG + Intronic
999432903 5:151539150-151539172 CTCAGAAGGGAGGCTTTTTTGGG - Intronic
1001082143 5:168675267-168675289 CCCTGCTGGGATCCTCTTGTTGG - Intronic
1001954902 5:175842562-175842584 CTCTGCAGAGATGGTGATGTGGG - Intronic
1003673038 6:8177489-8177511 CTGTGCAGGGCTGCTCTTGTTGG + Intergenic
1006647053 6:35522187-35522209 CTCTGGAGGGAGGCTTTGCTGGG - Intergenic
1008513397 6:52297897-52297919 ATCTGCAGTGTTGCTTTTCTTGG - Intergenic
1010159774 6:72839485-72839507 CACTGCAGGGATTATGTTGTGGG + Intronic
1012329283 6:97964097-97964119 CCTTGCAGGGATGCTTATGGAGG + Intergenic
1014121299 6:117728064-117728086 CTCTTCAGCGCTGCCTTTGTTGG + Intergenic
1014664285 6:124217205-124217227 CTCTCCCAGGATGCTTCTGTAGG - Intronic
1015350283 6:132210165-132210187 CTGTGCAGAGATTCTTGTGTGGG - Intergenic
1018198795 6:161377133-161377155 CTTTGCTGGGATGCTCTTATTGG - Intronic
1018593355 6:165452286-165452308 CTCTGCAGCTTTGCTTCTGTTGG - Intronic
1020531538 7:9344039-9344061 CTCTGCAGGGATTTTGTTCTAGG - Intergenic
1023733028 7:43210140-43210162 AGCTGCAGGGATCCTTCTGTGGG - Intronic
1024331003 7:48155362-48155384 TACTGCAGGGACTCTTTTGTAGG + Intergenic
1024537035 7:50445435-50445457 CTTTGCAGGGAGGCTTCTCTTGG - Exonic
1025283258 7:57643329-57643351 CTCTGCAGGGGGCATTTTGTAGG - Intergenic
1028279158 7:88898783-88898805 CTCTGCAGTGATGCTATTACTGG + Intronic
1030087538 7:105829919-105829941 CCCTGCAGGAAAGCTGTTGTGGG + Intronic
1030783936 7:113636823-113636845 CTCTCCTGGGGTGCTTTTGTGGG + Intergenic
1032577563 7:133071887-133071909 CTCTATAGGGATGCTTTTTCTGG - Intronic
1033414806 7:141152301-141152323 CTCTGCAGGGAGGCCCTTCTTGG + Intronic
1033824923 7:145177899-145177921 CACTGCACGGATACTGTTGTGGG - Intergenic
1034564637 7:151903687-151903709 CTCAGCAGGGTGGCTCTTGTAGG - Intergenic
1035047555 7:155978963-155978985 CTCTGTAGGGATAAGTTTGTGGG + Intergenic
1035084077 7:156241286-156241308 CTCAGAAGAGATGCTTTTGGAGG + Intergenic
1036115667 8:5958220-5958242 CTCTGCAGTTTTTCTTTTGTGGG + Intergenic
1036287609 8:7458345-7458367 CTGTGCAGGATTGCTTTGGTAGG - Intronic
1036333871 8:7853180-7853202 CTGTGCAGGATTGCTTTGGTAGG + Intronic
1037315738 8:17597441-17597463 CTCTGTTGGCCTGCTTTTGTAGG - Intronic
1037363465 8:18097880-18097902 CCCTGCAGGGATGTTGCTGTGGG + Intergenic
1039277731 8:35952089-35952111 CTCCACAGGGATGCTTTTCAGGG - Intergenic
1040605772 8:48929701-48929723 CTCTGCAGGGTACCTTTTGGGGG - Intergenic
1041756007 8:61313749-61313771 CTCAACAGGAATGCTGTTGTTGG - Intronic
1042559332 8:70061204-70061226 CTCTGCAGGGATGCTTTTGTAGG - Intronic
1044427543 8:92070648-92070670 CTTTGCAGGGAAGATTTTGGTGG - Intronic
1046260640 8:111763256-111763278 CTCTACAGTAATGCTTTTTTAGG - Intergenic
1046624038 8:116558368-116558390 GTGTGCAGGGATGCATTTATAGG - Intergenic
1047760885 8:127953286-127953308 CTGTGCAGGAATGCTTTTACTGG + Intergenic
1048855215 8:138681055-138681077 CTCTGCAGGCATGCAGTTGTTGG - Intronic
1049023735 8:139974646-139974668 GTCTACAGGGATGCTTTAGTGGG - Intronic
1049725104 8:144142173-144142195 CTCTGCAGGGATGGCTGTGGAGG + Intergenic
1055192232 9:73539297-73539319 CTCTGCAGGCAAGCATCTGTGGG - Intergenic
1057877445 9:98768580-98768602 CTCTGCAGAGGGGCTTCTGTGGG - Intronic
1060066905 9:120510284-120510306 CTCTGTGGGGATGCATTTGCTGG - Intronic
1060740124 9:126092385-126092407 CTATGCTGGTGTGCTTTTGTGGG + Intergenic
1061928807 9:133821707-133821729 CTCAGCTGTGTTGCTTTTGTGGG + Intronic
1061998826 9:134205504-134205526 CTCTGCAGGGATGCTTGATGGGG + Intergenic
1186415462 X:9379845-9379867 CTCTGCAGGGCTGCTTTCCCTGG + Intergenic
1189295421 X:39914329-39914351 CTCTGCAGGGTTGGTTTCTTCGG - Intergenic