ID: 1042560496

View in Genome Browser
Species Human (GRCh38)
Location 8:70069912-70069934
Sequence CACCGCGCGGGAGCTTCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042560487_1042560496 21 Left 1042560487 8:70069868-70069890 CCGCACGCTCGGCGGCTCTGCAG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1042560496 8:70069912-70069934 CACCGCGCGGGAGCTTCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 53
1042560485_1042560496 28 Left 1042560485 8:70069861-70069883 CCCGGGACCGCACGCTCGGCGGC 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1042560496 8:70069912-70069934 CACCGCGCGGGAGCTTCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 53
1042560486_1042560496 27 Left 1042560486 8:70069862-70069884 CCGGGACCGCACGCTCGGCGGCT 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1042560496 8:70069912-70069934 CACCGCGCGGGAGCTTCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042560496 Original CRISPR CACCGCGCGGGAGCTTCCCG GGG Intronic
907408780 1:54270360-54270382 CACCGCACAGGAGCTGCCGGGGG - Intronic
915516308 1:156414651-156414673 CACCGCCCGGGAGCTGTCCGTGG + Exonic
919231481 1:194779960-194779982 CACCAGGCGGGACCTTCCTGTGG + Intergenic
1067436595 10:46283096-46283118 CCCCGCGCGGGAGGGTGCCGCGG - Intergenic
1072802917 10:98405686-98405708 CACTGCGCTGGAGCTGCCAGGGG + Intronic
1075370047 10:121928028-121928050 CGCCGCCCGGGAGCCTCCCGAGG + Exonic
1079451196 11:20601230-20601252 CCCGGAGCAGGAGCTTCCCGCGG + Exonic
1080418529 11:32091187-32091209 CACCGCGCGCCATCGTCCCGAGG - Exonic
1083741309 11:64712942-64712964 CACCGGGCGGCCGCTCCCCGGGG + Intronic
1088893139 11:114059924-114059946 CCGCGCGCCGGGGCTTCCCGGGG + Intronic
1094807637 12:34107884-34107906 GACCCCGCGGGCGCTTCCCCTGG - Intergenic
1097664898 12:62467117-62467139 CACCGGGAGGGAGCTGCCTGTGG + Exonic
1100309287 12:93378672-93378694 CGCGGCCCGGGACCTTCCCGGGG - Intronic
1101239573 12:102824633-102824655 CACAGGGCGGGAGCTGTCCGTGG + Intergenic
1106420065 13:29578678-29578700 CACCGGGCAAGAGCTACCCGGGG - Intronic
1107943003 13:45391327-45391349 CACCGCGCGCCATCGTCCCGAGG + Intergenic
1112325188 13:98439166-98439188 CATAGAGCGGGAGCTGCCCGTGG - Exonic
1129185111 15:73901339-73901361 CACAGCCCTGGAGCTTCCCAGGG + Intergenic
1132459125 16:41597-41619 CACCACGGGGGAGCTTCACCCGG + Intergenic
1132915494 16:2341416-2341438 CACCTGGCGGGAGGGTCCCGGGG + Intergenic
1136566493 16:31073606-31073628 GGCCGCGTGGGAGCTGCCCGGGG + Intronic
1142121712 16:88389818-88389840 CACAGCGGGGGAGCCTCCTGGGG - Intergenic
1142501576 17:336092-336114 CACCGAGCCGGTGCTTCCCGAGG + Intronic
1151431421 17:74066176-74066198 CACAGCGCAGGAGCTTCCCTGGG - Intergenic
1157595629 18:48862093-48862115 GACCCCGAGGCAGCTTCCCGAGG + Intronic
1158633998 18:59140143-59140165 CCCAGCGCGGGAGCTTCGGGTGG - Intronic
1161619393 19:5290402-5290424 CACCGCGGGGGAGCCCCCAGAGG - Intronic
1161797008 19:6393070-6393092 CACCGAGCGGCGGCTTCCCCGGG - Exonic
1162413011 19:10517670-10517692 CACCGCGATGGAGCGTCCCTGGG - Intronic
1162477914 19:10911970-10911992 GGCCGAGCGGGAGCTTCCCCAGG + Intronic
1165891518 19:39115407-39115429 CAGCCCTCGGGAGCTCCCCGTGG + Intergenic
1168641411 19:58034142-58034164 CACCGCGCGCGGGCTTCGCTCGG - Exonic
925176028 2:1784454-1784476 CTGGGCGTGGGAGCTTCCCGGGG - Intergenic
927218217 2:20682061-20682083 CCACGCACGGGAGCTTCCTGTGG - Intergenic
931694281 2:64860029-64860051 CACCCCGCGGCTGCCTCCCGGGG - Intergenic
933935977 2:87204126-87204148 CACTGCGCCTGAGCTTCCCAAGG - Intergenic
937221406 2:120344877-120344899 CTCCCCGCTCGAGCTTCCCGGGG - Intergenic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1175736858 20:61393204-61393226 GTCCTCGCGGGAGCTTCCCTGGG + Intronic
1181745555 22:24953031-24953053 CCCTGTGCGGGATCTTCCCGCGG - Intronic
1182194896 22:28506074-28506096 CACTGGGCGGGACCTTCCTGCGG + Intronic
1183577378 22:38700690-38700712 CGCCGCGCGGAACCTTCCCTCGG - Intronic
1183966367 22:41445298-41445320 CCCAGCGGGGGAGCTTGCCGAGG - Intronic
1184265566 22:43344050-43344072 CCCCGTGCGGGGGCCTCCCGCGG - Intergenic
964183353 3:153913677-153913699 CACTGGGCGGGAACTTCCTGTGG + Intergenic
985527192 5:412017-412039 CACCCTGCAGCAGCTTCCCGGGG - Intronic
1002021348 5:176366028-176366050 CGCGGCTCGGGAGCATCCCGGGG + Intronic
1008685599 6:53922892-53922914 CCCCGCGCGCCATCTTCCCGTGG + Exonic
1014154221 6:118092651-118092673 CACAGAGGTGGAGCTTCCCGAGG + Intronic
1018067439 6:160133834-160133856 GGCCGGGTGGGAGCTTCCCGCGG + Intronic
1018673325 6:166197614-166197636 CACCGCGAGGATGCTTCCCATGG - Intergenic
1035064422 7:156094839-156094861 CACCGAGCAGAAGCTTCGCGGGG + Intergenic
1035171636 7:157020725-157020747 CACCACGCGGGACCCTCCCGGGG + Intergenic
1042560496 8:70069912-70069934 CACCGCGCGGGAGCTTCCCGGGG + Intronic
1049242249 8:141543917-141543939 CACCCCCAGGAAGCTTCCCGAGG + Intergenic
1060485885 9:124045845-124045867 CACCGCGCGGGCTCTCTCCGCGG - Intergenic
1060695729 9:125707297-125707319 CAAGGAGCGGTAGCTTCCCGCGG + Intergenic
1061000443 9:127899471-127899493 CGCCGCGCGGGAGCAGGCCGCGG - Intronic
1062375784 9:136261282-136261304 CACCGCAGGCGAGCTTCTCGTGG + Intergenic