ID: 1042560500

View in Genome Browser
Species Human (GRCh38)
Location 8:70069936-70069958
Sequence GCTGGTGGGGAGGCGCGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 897
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 836}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042560500_1042560513 9 Left 1042560500 8:70069936-70069958 CCGACCCGCGCCTCCCCACCAGC 0: 1
1: 0
2: 4
3: 56
4: 836
Right 1042560513 8:70069968-70069990 CCCAGCCAGCCCCAGATCCAAGG 0: 1
1: 0
2: 2
3: 40
4: 406
1042560500_1042560515 10 Left 1042560500 8:70069936-70069958 CCGACCCGCGCCTCCCCACCAGC 0: 1
1: 0
2: 4
3: 56
4: 836
Right 1042560515 8:70069969-70069991 CCAGCCAGCCCCAGATCCAAGGG 0: 1
1: 0
2: 2
3: 26
4: 259
1042560500_1042560517 16 Left 1042560500 8:70069936-70069958 CCGACCCGCGCCTCCCCACCAGC 0: 1
1: 0
2: 4
3: 56
4: 836
Right 1042560517 8:70069975-70069997 AGCCCCAGATCCAAGGGAACAGG 0: 1
1: 0
2: 1
3: 21
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042560500 Original CRISPR GCTGGTGGGGAGGCGCGGGT CGG (reversed) Intronic
900123416 1:1059149-1059171 GCGGGCGGAGAGGCGCTGGTGGG + Intergenic
900990321 1:6095637-6095659 CCTGGTGGGGAGGGACGGGCAGG + Intronic
901278556 1:8012962-8012984 GATGGTGGGGAGGGGAGGATGGG - Exonic
901382152 1:8881614-8881636 GCTGCTTGGGAGACTCGGGTGGG + Intergenic
901552015 1:10002609-10002631 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
901673037 1:10867096-10867118 GCTGCGGGGGCGGCGGGGGTTGG - Intergenic
901791346 1:11654981-11655003 GCTGGGGAGGGGGCGCGGCTGGG + Intronic
902925592 1:19693876-19693898 GCTGTTGGGGAGCCCTGGGTGGG + Intronic
902955691 1:19923033-19923055 GCTGGTGGGGAGCCCCTGGAAGG - Intronic
903052598 1:20612672-20612694 GTTGGTGGGGCGGGGCGGGGTGG + Intronic
903067836 1:20710710-20710732 GCTGTGGGAGAGGCGTGGGTGGG + Intronic
903163806 1:21507462-21507484 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
903468362 1:23568118-23568140 GCGGGCGGGGAGGGCCGGGTAGG - Intergenic
904119280 1:28186087-28186109 GCTACTGGGGAGGCTGGGGTGGG - Intronic
904557435 1:31374302-31374324 GCTGCTGGGGAGGCTAAGGTAGG - Intronic
904586637 1:31584455-31584477 GGTGGTGGGGCGGGGCGGGGTGG - Intronic
904609240 1:31715908-31715930 GGTGGTGGGTAGGCGCCAGTGGG - Intergenic
904769424 1:32872552-32872574 GCTGGTGGGGCGGGGCCGGGTGG - Intergenic
904809345 1:33153130-33153152 GCTGGAGGGGAGGGGCAGGCAGG + Intronic
905523151 1:38615478-38615500 GGTGGTGGGGTGGCGGGGGGTGG - Intergenic
905559141 1:38912520-38912542 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
906249994 1:44303658-44303680 GCTGGTGGGGAGGGGTGTGGGGG + Intronic
907027798 1:51138797-51138819 GCTGGTTGGGAGGCTGGGGCAGG - Intronic
907209166 1:52804131-52804153 GCTAGTGGGGAGGCTCAGGCAGG + Intronic
908014352 1:59815348-59815370 GCAGGTGTGTGGGCGCGGGTTGG + Intronic
908203283 1:61819612-61819634 GGCGGTGGGGGGGCGCGGGTGGG + Intronic
908721332 1:67129342-67129364 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
909041811 1:70662386-70662408 GGTGGCGGGGAGGCGGGGGAAGG - Intergenic
909075666 1:71047803-71047825 TCTGGTGGCGAGGCGCGCGGAGG + Intronic
909736465 1:78968509-78968531 GGTGGGGGGGAGACGGGGGTCGG + Intronic
910449179 1:87329253-87329275 GCGGGTGGAGAGCCGCGGGCCGG + Intronic
910759997 1:90724179-90724201 GGGGGTGGGGAAGCGCGCGTGGG - Intergenic
911623420 1:100093289-100093311 GCTGTTGGGGAGGCTGAGGTGGG - Intronic
912450443 1:109764760-109764782 GCAGGAGGGGAGGCGGGGGCGGG + Intronic
912813269 1:112809877-112809899 TCTGGTGGGCAGGGGCGGGGGGG - Intergenic
912973148 1:114303015-114303037 GCTGCTTGGGAGGCGGAGGTGGG - Intergenic
913075575 1:115338332-115338354 GGTGGTGGGGAGGGGAGGGATGG - Intergenic
913198730 1:116478712-116478734 GCAGGTGGGGAGGAGAGGGTGGG - Intergenic
913250615 1:116909880-116909902 GCCGGATGGGAGGCGCGGGCGGG + Intergenic
913252008 1:116919507-116919529 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
913451325 1:118994549-118994571 GGTGGTGGGGAGGCTGAGGTTGG + Intergenic
913644750 1:120845178-120845200 GCTGGCGGGGAGGCACAGGCGGG + Intergenic
914081977 1:144418405-144418427 GCTGGCGGGGAGGCACAGGCGGG - Intergenic
914099127 1:144568424-144568446 GCTGGCGGGGAGGCACAGGCGGG + Intergenic
914176884 1:145286905-145286927 GCTGGCGGGGAGGCACAGGCGGG - Intergenic
914299860 1:146369240-146369262 GCTGGCGGGGAGGCACAGGCGGG - Intergenic
914531612 1:148528397-148528419 GCTGGCGGGGAGGCACAGGCGGG - Intergenic
914636779 1:149559332-149559354 GCTGGCGGGGAGGCACAGGCGGG + Intergenic
914901926 1:151715788-151715810 GCTGGAGGGGTGGAGCGGCTGGG - Intronic
915129279 1:153685972-153685994 GCTGGTGGGGAGCAGCAGATGGG + Intronic
915334071 1:155130373-155130395 GCTGGTGGGGAGGGGCTGGTGGG + Intronic
915461310 1:156072289-156072311 GCGGGTGGGGAAGGGGGGGTGGG - Exonic
915782119 1:158563532-158563554 GCTGGAGGGGAGGCGTGGTAGGG + Exonic
916128120 1:161589241-161589263 GCTGGTGGGGAGAGGTTGGTGGG + Intronic
916138037 1:161671071-161671093 GCTGGTGGGGAGAGGTTGGTGGG + Intronic
917472790 1:175340211-175340233 GTTGGTGGGGTGGCGGGGGGCGG + Intronic
917610638 1:176685669-176685691 CCTGGTGGGGAGGAGGGGGCCGG - Intronic
918055870 1:181022097-181022119 GCTGGGAGGGAGGCGGGGGCGGG - Intronic
919682105 1:200445812-200445834 GCTGCTTGGGAGGCTGGGGTGGG - Intergenic
920136513 1:203773670-203773692 ATTGGTGGGGGGGTGCGGGTGGG - Intronic
920214696 1:204353832-204353854 TTTGGTGGGGTGGTGCGGGTGGG - Intronic
920504735 1:206507819-206507841 GCGGGTCGGGAGGCCCGGGGCGG - Exonic
921092948 1:211860299-211860321 GCAGGTGGGTAGGGGCGGGAGGG + Intergenic
921175272 1:212587938-212587960 CCTGCTGGGGCGGCGGGGGTGGG + Intronic
921871601 1:220146404-220146426 TCTGCTGGGGAGGCTGGGGTGGG + Intronic
921923110 1:220690326-220690348 GCTGGGGCGGAGGAGCGGGCGGG + Exonic
922218933 1:223543277-223543299 GCTGGAGGGGAGGGGGTGGTAGG - Intronic
922466780 1:225849851-225849873 GCTGGTGGGGATGCAGGGCTGGG + Intronic
922542353 1:226428926-226428948 GCTGGAGGAGAGGTGCGGGTAGG - Intergenic
922605069 1:226885176-226885198 GCTGGTGGAGAGGTGTGGGTGGG + Intronic
922729412 1:227942074-227942096 GCTGCTGGGGTGGCCCGGGCTGG - Intronic
922880340 1:228975729-228975751 GGAGGTGGGGAGGGGCAGGTGGG - Intergenic
923261031 1:232268258-232268280 GCAGTTGGGGAGGCCAGGGTGGG - Intergenic
924436779 1:244049164-244049186 GCTGTTGGGGCGGCGGGGGGCGG + Intronic
924659860 1:246006314-246006336 GCTGGAGGGGCGGCGGGGGGCGG + Intronic
924770091 1:247072260-247072282 GCTGCTTGGGAGGCTCAGGTGGG - Intronic
1063383995 10:5604504-5604526 GCGAGTGGGGAGGCCCGGGCAGG - Intergenic
1063464170 10:6232366-6232388 CGTGGTGGGGAGGCCCAGGTGGG - Intronic
1063566799 10:7178162-7178184 GGTGGTGGGGAGGTGCAGGCAGG - Intronic
1063702120 10:8394729-8394751 GCTACTGGGGAGGCTGGGGTGGG + Intergenic
1063794885 10:9502793-9502815 GCTAGTGGGGAGGTTCAGGTGGG - Intergenic
1065099666 10:22321039-22321061 GCTGGGGGGGCGGCGGGGGGAGG + Intronic
1065344313 10:24734356-24734378 GCTACTTGGGAGGCTCGGGTAGG - Intergenic
1065351225 10:24797382-24797404 GCTGCTTGGGAGGCTAGGGTAGG - Intergenic
1066382191 10:34911310-34911332 GGTGGGGGGGGGGGGCGGGTGGG - Intergenic
1066418409 10:35242153-35242175 GCTACTGGGGAGGCTCAGGTGGG - Intergenic
1066526355 10:36283818-36283840 GATGGCGGGGAGGGGCGTGTGGG + Intergenic
1067106711 10:43371512-43371534 GCTGTTGGGGAGGGGCGGGCTGG - Intergenic
1067175530 10:43943324-43943346 CCTTGTGGGGAAGCGTGGGTGGG + Intergenic
1067304705 10:45050929-45050951 GGTGGTGGGGTGGAGAGGGTAGG + Intergenic
1067334863 10:45352686-45352708 GTTTGTGGTGAGGCGTGGGTGGG - Intergenic
1068737587 10:60431647-60431669 GCTGGTGGGGGGGCTAGGGAAGG + Intronic
1068880876 10:62047704-62047726 GCTGGTGGGCAGGAGTGGGATGG - Intronic
1069180978 10:65358027-65358049 GCTGTTGGGGAGGCTGTGGTAGG - Intergenic
1069498295 10:68927022-68927044 GCTGGTTGGGAGGCTGAGGTGGG - Intronic
1069680805 10:70283934-70283956 CCTGGTCGGGAGGCGAGGGGCGG - Intergenic
1069699987 10:70416774-70416796 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1069736740 10:70661597-70661619 GCTGGTGGGGAGATGTGGGCAGG - Intergenic
1069831341 10:71284151-71284173 GCTGTCGGGGAGGCGCAGGGTGG + Intronic
1069886985 10:71630131-71630153 GCTACTGGGGAGGCTGGGGTGGG - Intronic
1070218292 10:74410567-74410589 GCTGCTGGGGAGGCTGAGGTAGG + Intronic
1070398830 10:76035272-76035294 GCGGGTGGGGAGACGGGGGTTGG - Intronic
1070660721 10:78303475-78303497 GATGGTGGGGCGGGGCGGGGCGG - Intergenic
1070796235 10:79218361-79218383 GCTGCTTGGGAGGCTGGGGTGGG + Intronic
1070914531 10:80144505-80144527 GCAGGTGGGGCGGGGCGGGCGGG - Intronic
1071579405 10:86756305-86756327 GCTTGTGGGGAGGGGCCGGCGGG + Intergenic
1071594317 10:86908090-86908112 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
1071623924 10:87148553-87148575 GTTTGTGGGGGGGCGGGGGTTGG + Intronic
1071997385 10:91162292-91162314 TCTGGTGGGGTGGCGGGGGTGGG + Intergenic
1072081813 10:92040247-92040269 GCTACTGGGGAGGCTGGGGTGGG + Intergenic
1072668990 10:97415417-97415439 TCTGGTAGGTAGGCTCGGGTGGG + Intronic
1072691998 10:97578145-97578167 GCTGGTGGGGAGGGTGGGGTGGG - Intronic
1073084958 10:100882420-100882442 GCTGGTGGGGAGGGGCAGTGAGG + Intergenic
1073210803 10:101800884-101800906 GCTACTGGGGAGGCTCAGGTGGG - Intronic
1073253954 10:102139213-102139235 GCTGCTGGGGAGGTGGGGATTGG - Exonic
1073324598 10:102634948-102634970 GGTGGTGGGGAGGCCGGGGTGGG + Intergenic
1073347638 10:102796189-102796211 GGTGGTGGGGCGGCGGGGGAAGG + Intronic
1073417230 10:103394744-103394766 GCTGGTGGGGGGGCGGGGGGCGG - Intronic
1073498859 10:103918259-103918281 GCTGGCGGGGAGACCGGGGTTGG - Intergenic
1073777293 10:106800631-106800653 GCTGCTGGGGAGGCTGAGGTAGG - Intronic
1074086831 10:110214627-110214649 GGTGGTAGGGAGGAGGGGGTGGG - Intronic
1074485544 10:113874350-113874372 GGTGGTGGGGAGGAGTGGGAAGG - Intronic
1075787465 10:125059771-125059793 GCTGGTGGGGGTGGGCGGGCAGG - Intronic
1076374187 10:129972697-129972719 GCTGCGGCGGAGGCGCGGGGTGG - Intergenic
1076392218 10:130111382-130111404 GCTGGTTGGGAGGCCCCGGAAGG + Intergenic
1076434771 10:130432548-130432570 GCAGGTGGAGAGGAGCTGGTCGG + Intergenic
1076879043 10:133231062-133231084 GCTGGCGGGGAGCCGGGGGCGGG - Exonic
1076890937 10:133283032-133283054 TCGGGTGGGCAGGCGCGGGTGGG - Intronic
1076903548 10:133351443-133351465 GGTGGTGGGGAGGTGGGGTTGGG - Intronic
1077136842 11:1004012-1004034 GGTGGCGGGGAGGTGGGGGTGGG + Intronic
1077360677 11:2139048-2139070 GCTGGAGGGGGAGCGCGGGGGGG + Intronic
1077476138 11:2791522-2791544 GAGGGAGGGGAGGCTCGGGTCGG - Intronic
1077515339 11:2998426-2998448 GATGGTGGGGGGGCGGGGGCAGG - Intergenic
1077601516 11:3578047-3578069 TATGGTGGGGAGGCGGGGGGGGG - Intergenic
1078003107 11:7513612-7513634 GGTTGCGGGGAGGCCCGGGTGGG - Intronic
1078235518 11:9481274-9481296 GCTGTTTGGGAGGCGAGGGCAGG + Intronic
1080979648 11:37385891-37385913 GCTGGTGGTGGGGGGCGGGGGGG + Intergenic
1081540436 11:44030803-44030825 GCTGGTCTGGAGGCTGGGGTGGG + Intergenic
1081627981 11:44666738-44666760 GCTGGTGGAGTGGGGAGGGTAGG + Intergenic
1081831829 11:46121238-46121260 GGGGGTGGGGAGGAGGGGGTTGG + Intergenic
1081935146 11:46899032-46899054 GCTGGAGGGAAGGCAGGGGTGGG + Exonic
1081969150 11:47186318-47186340 CCTGGAGGGGACGCGCGGGTAGG - Intronic
1082055649 11:47813712-47813734 GCTGCTAGGGAGGCTGGGGTGGG + Intronic
1083176226 11:60951814-60951836 GCTGCAGGAGAGGCGCGGGGAGG - Intronic
1083327885 11:61882529-61882551 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1083750812 11:64759631-64759653 GCTGCTGGGGAGCCTGGGGTGGG - Intronic
1083799988 11:65041192-65041214 GGGGGTGGGGAGCGGCGGGTCGG - Exonic
1083912226 11:65716927-65716949 GCTGGTAGGGAGGCAGGGTTAGG - Exonic
1083990517 11:66243438-66243460 GCTGGAGGGGAGGGGAGGGAAGG - Exonic
1084111261 11:67015452-67015474 CCTGGTGTGGAGGCGGTGGTGGG + Intronic
1084270551 11:68027073-68027095 GCAGGTGGGGAAGCCGGGGTGGG - Intronic
1084672563 11:70615906-70615928 GTTAGTGGGGAGGTGAGGGTGGG + Intronic
1084980639 11:72826841-72826863 GCTGGTGGGGAGGAGAGGTGGGG - Intronic
1085378323 11:76088485-76088507 GCGGGGGAGGGGGCGCGGGTGGG - Intronic
1085437713 11:76523796-76523818 GCTGGTTGGGAGGCTGAGGTGGG + Intronic
1085574421 11:77589757-77589779 GGAGGCGGGGAGGCGCGGGGAGG - Exonic
1085867549 11:80312380-80312402 GATGGTGGAGAGGGGCTGGTGGG + Intergenic
1086898733 11:92342288-92342310 GATGGTGGGGAGGGGAGGCTTGG - Intergenic
1086912418 11:92488453-92488475 GCTGGTTGGGGGGCGGGGGGGGG - Intronic
1088127850 11:106449997-106450019 ACTGGTGGGGAGGAGTGGGAAGG - Intergenic
1088175273 11:107046359-107046381 GCTGGTGGGGAGGAGAGAATGGG + Intergenic
1088239019 11:107754997-107755019 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
1088254938 11:107894452-107894474 GCTGGTTGGGAGGCTGAGGTGGG + Intronic
1088304636 11:108395017-108395039 GCTACTGGGGAGGCGGAGGTGGG + Intronic
1088506850 11:110535399-110535421 GGTGGTGGGGAGGCGGGGGTGGG + Intergenic
1089630492 11:119781289-119781311 GCAGGTGGGGAGGGGAGGGCTGG - Intergenic
1089796663 11:120986297-120986319 GCGGGAGGGGAGGGGCGGGGCGG + Exonic
1089861924 11:121597503-121597525 GCTGGAGTGCAGGGGCGGGTGGG + Intronic
1090025537 11:123164413-123164435 GCTACTGGGGAGGCTAGGGTGGG - Intronic
1090051960 11:123387722-123387744 ACTTGTGGGGCGGGGCGGGTGGG - Intergenic
1090074658 11:123572788-123572810 GCTGGGGCAGAGGCGCAGGTAGG + Intronic
1090074738 11:123573036-123573058 GCTGGGGCAGAGGCGCAGGTAGG + Intronic
1090327920 11:125904696-125904718 GCTGGAGGGGAGATGCGGGAAGG + Intronic
1090643113 11:128746116-128746138 GCTGGTGTGGAGGTGTGGGCAGG + Intronic
1091184911 11:133638387-133638409 GCTGGTGGGGAGGGAAGGGAAGG - Intergenic
1091283435 11:134395214-134395236 GCGGGTGGGGAAGCGGGGATGGG + Intronic
1091550034 12:1530239-1530261 GCTGGTGGGCAGGAGCGAGCCGG + Intronic
1091586957 12:1822057-1822079 GCCGGTGGGGAGGTGGGGGTGGG - Intronic
1091649799 12:2301516-2301538 TCTGGTGGGGTGGCGGGGGGCGG - Intronic
1091823188 12:3491353-3491375 GCGGGTGGAGAGGGGCGGGGAGG + Exonic
1092267577 12:6994576-6994598 GCTGCTAGGGAGGCTCAGGTGGG - Intronic
1094184176 12:27623594-27623616 GCTAGTGGGGAGGCTGAGGTGGG + Intronic
1094218475 12:27970195-27970217 GCTGGCCGGGCGGCGCAGGTTGG + Exonic
1095862299 12:46931057-46931079 GCTAGTTGGGAGGCTGGGGTGGG + Intergenic
1095953067 12:47791852-47791874 TGAGGTGAGGAGGCGCGGGTGGG - Exonic
1096072419 12:48782667-48782689 GCGGATGGGGAGGAGCGTGTAGG + Exonic
1097142677 12:56915867-56915889 GCAGGTGGCCAGGCGCAGGTGGG - Intergenic
1097190386 12:57216774-57216796 GCTGGGGGCGGGGCGCGGGCGGG - Exonic
1097201209 12:57280387-57280409 GCTGTTGCTGAGGCGTGGGTGGG + Exonic
1097243630 12:57592837-57592859 GCAGGTGGGGAGGAGGGGGCAGG + Intronic
1097576902 12:61405762-61405784 GCGGGTGGGGAGGAGCGGGTGGG + Intergenic
1098125493 12:67288372-67288394 GCTCTTGGGGAGGCGGAGGTGGG - Intronic
1098136945 12:67412909-67412931 GATGGTTGGGAGGCTGGGGTGGG + Intergenic
1098671553 12:73235937-73235959 GCAGCTGGGGAGGCACGGCTGGG - Intergenic
1098907855 12:76180177-76180199 GCTGGTGGGTGGGAGAGGGTAGG - Intergenic
1100223569 12:92533386-92533408 GCTAGTGGGGTGCCGGGGGTGGG + Intergenic
1100391384 12:94148663-94148685 GCTCGCGGGGAGGCGCGGAGGGG - Intergenic
1100646962 12:96541887-96541909 GCTGGTGGGGAGGGGGTGCTAGG - Intronic
1101322681 12:103686880-103686902 GCTGGTGGGAAGGCCAGAGTTGG - Intronic
1102078217 12:110076786-110076808 GCTGCTTGGGAGGCTGGGGTAGG - Intergenic
1102238535 12:111309573-111309595 GTTGGTGGGGAGGTGGGGGTGGG - Intronic
1102278269 12:111599132-111599154 CCGAGCGGGGAGGCGCGGGTTGG + Exonic
1102492475 12:113297530-113297552 GGTGGTTGGGAGGAGGGGGTGGG - Exonic
1102677573 12:114668891-114668913 GTTGGTGCGGAGTCGCGGGGGGG - Intergenic
1102699753 12:114828873-114828895 GCTGGGGGTGAGGTGAGGGTGGG + Intergenic
1102907626 12:116688858-116688880 GGTGGTGGGGTGGGGTGGGTGGG + Intergenic
1102915165 12:116747166-116747188 GCTAGTGGGGAGGCTGAGGTGGG - Intronic
1102955568 12:117056482-117056504 GCTGCTGGGGAGGCTGCGGTGGG - Intronic
1103364910 12:120374923-120374945 GCTGTTGGGGAGGCTGAGGTGGG - Intergenic
1103432900 12:120903723-120903745 CGTGGGGGGGGGGCGCGGGTTGG - Intronic
1103576136 12:121878783-121878805 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
1103766402 12:123283373-123283395 GCTACTTGGGAGGCGGGGGTGGG - Intergenic
1104140809 12:125984203-125984225 TCTGGTGGGGTGGCGGGGGGCGG + Intergenic
1104892868 12:132148744-132148766 GGTGGGGGTGAGGGGCGGGTGGG - Intronic
1105410451 13:20167410-20167432 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
1105443555 13:20434596-20434618 GTGGGTGGGGGGGCGCGTGTGGG - Intronic
1105531394 13:21224024-21224046 GCTGCTGGGGAGGCGGAGATGGG - Intergenic
1105900063 13:24746005-24746027 GCTGTGGCGGAGGCGCGGGCTGG - Intergenic
1110918608 13:81056325-81056347 GCTAGTGGGGAGGCTGGGGCAGG - Intergenic
1111474215 13:88724981-88725003 GCTGTTGGGGAGGCGCAGCTGGG + Intergenic
1112492786 13:99882550-99882572 GCTAGTGGGGAGGCTGAGGTGGG + Intronic
1112652538 13:101415803-101415825 GCGGGTGGGGAGGTGGGGGTGGG - Intronic
1112682036 13:101777850-101777872 GCTAGTCGGGAGGCTAGGGTAGG + Intronic
1113082757 13:106535276-106535298 GCTGGCGGGTGGGCGCGGGGCGG + Intergenic
1113120404 13:106918161-106918183 GCCGGTGGGGAGCCGAGGCTGGG + Intergenic
1113358093 13:109602253-109602275 TCTGGTGGGGAGGCACTGGGAGG - Intergenic
1113521042 13:110941127-110941149 CCTGGTGGGGTGGAGGGGGTGGG + Intergenic
1113677021 13:112214618-112214640 GCTGGAGGGGAGGAGGGGGATGG + Intergenic
1113677033 13:112214646-112214668 GCTGGAGGGGAGGAGGGGGATGG + Intergenic
1113693118 13:112326116-112326138 GCTCGTGGGGAGGTGCCGGTGGG - Intergenic
1114040678 14:18675612-18675634 GCTACTGGGGAGGCTCAGGTAGG + Intergenic
1114315398 14:21505195-21505217 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
1114519039 14:23321560-23321582 GCCGGTGGGGAGGCCGGGGAGGG + Exonic
1114658657 14:24331170-24331192 GCTGGAGGGGAGGGGCCTGTGGG - Intronic
1114849006 14:26359932-26359954 GCTGCTCGGGAGGCGGAGGTGGG + Intergenic
1115239436 14:31240298-31240320 GATGGTGGGGAGGGGCGAGGAGG - Intergenic
1115486106 14:33912930-33912952 GCTGGTGGGGAGGGGAGAGGAGG - Intergenic
1116016083 14:39408885-39408907 GCTGCTTGGGAGGCCCAGGTGGG - Intronic
1116798233 14:49414434-49414456 GCTGCTTGGGAGGCTAGGGTGGG + Intergenic
1116919666 14:50560105-50560127 GCTGGTGGGAAGGAGTGGGGAGG - Exonic
1117029225 14:51651836-51651858 TCGGGTCGGGAGGCGTGGGTGGG + Intronic
1117162272 14:53001391-53001413 GTGGGTGGGGAGGGGCGTGTCGG + Intergenic
1117875986 14:60249881-60249903 GGTGGCGGGGAGGCGGGGGCGGG + Intronic
1117881415 14:60316668-60316690 GCTGGTGGGGAGGGGTGGCAGGG + Intergenic
1118582915 14:67322234-67322256 GCTGCTTGGGAGGCTGGGGTGGG + Intronic
1119217956 14:72883679-72883701 GCACGTGGGGAGGCCCAGGTGGG + Intronic
1119325117 14:73755254-73755276 GCTGGTGGGGAAGAGCTGGTGGG - Intronic
1119531218 14:75362617-75362639 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
1119771049 14:77220927-77220949 GTGGGAGGGGAGGCGTGGGTGGG - Intronic
1120758970 14:88269546-88269568 GCTACTGGGGAGGCTGGGGTGGG - Intronic
1120863625 14:89276709-89276731 GCAGGTGGGGTGGGGAGGGTAGG + Intronic
1121025987 14:90616507-90616529 GCTGGGGGGGAGGTGGGGGCTGG + Intronic
1121203515 14:92140800-92140822 GCTGCTTGGGAGGCTGGGGTGGG + Intronic
1121278252 14:92682250-92682272 GTAGGTGGTGAGGCGGGGGTGGG - Intronic
1121641440 14:95487077-95487099 GCAGGTGCGGAGGGGCGGGTGGG - Intergenic
1121652214 14:95566838-95566860 GCTGCTAGGGAGGCTGGGGTAGG + Intergenic
1121994406 14:98591065-98591087 GCAGTTGGGGTGGCGGGGGTGGG - Intergenic
1122056340 14:99100833-99100855 GCAGGTAGGGAGGGGTGGGTGGG - Intergenic
1122106370 14:99459956-99459978 TTTTGTGGGGAGGCGAGGGTTGG - Intronic
1122231127 14:100306700-100306722 GCGGGAGGGGACGCGCGGGGTGG + Intergenic
1122492002 14:102123910-102123932 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1122606053 14:102948235-102948257 GGTGGAGGGGAGTCGGGGGTGGG + Intronic
1123671705 15:22665053-22665075 GCTGATGGGGAGGAGCCGGCGGG + Intergenic
1123684412 15:22786900-22786922 GCAGGTGGGGGCGCCCGGGTCGG + Intronic
1123691247 15:22840030-22840052 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1123893379 15:24803351-24803373 GCCGGTGGGGAGGTGCCGCTGGG - Intergenic
1124016979 15:25885880-25885902 GCTGCTGGGGAGGCTGAGGTAGG - Intergenic
1124155023 15:27218119-27218141 GCTGCTTGGGAGGCGGAGGTGGG - Intronic
1124323745 15:28738278-28738300 GCTGATGGGGAGGAGCCGGCGGG + Intronic
1124527637 15:30471519-30471541 GCTGATGGGGAGGAGCCGGCGGG + Intergenic
1124771022 15:32536183-32536205 GCTGATGGGGAGGAGCCGGCGGG - Intergenic
1125539340 15:40460734-40460756 GCTGCTGGGGAGGTGAGGGCTGG + Intronic
1125999839 15:44198210-44198232 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
1126502902 15:49366699-49366721 GCGGGTGGGGTGGCGCGGCGCGG + Intronic
1126695563 15:51322673-51322695 CCTAGTGGGGAAGCGGGGGTGGG - Intronic
1127305905 15:57705721-57705743 GCTGGGGAGGTGGCGGGGGTGGG + Intronic
1127867094 15:63042191-63042213 GCTGCCGGGGAGGCGCTGGCGGG + Intergenic
1128001413 15:64196103-64196125 GCTGTTTGGGAGGCTGGGGTGGG + Intronic
1128008654 15:64269913-64269935 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1128333783 15:66773211-66773233 GGGGGTGGGGAGGGGTGGGTGGG + Intronic
1128791009 15:70434035-70434057 GCTGGTCGGCAGGGGTGGGTGGG - Intergenic
1129205557 15:74035318-74035340 GCTGGTGGGGAGGCCAAGCTGGG - Intronic
1129253525 15:74321339-74321361 ACTGGGGGGCAGGCGGGGGTGGG - Intronic
1129338623 15:74870117-74870139 TCTGGTGGGGAGTCCTGGGTGGG - Intronic
1129367154 15:75063298-75063320 GCTACGGGGGAGGCTCGGGTGGG - Intronic
1129522331 15:76193756-76193778 GCTGGTGGGGAGGCAGGGGCAGG - Intronic
1129786549 15:78313813-78313835 GCTGGTGTTGAGGGGCGGCTGGG - Intergenic
1130385465 15:83407375-83407397 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
1130506451 15:84547884-84547906 GAGGGTGGGGAGGTGCTGGTTGG - Intergenic
1130529685 15:84736838-84736860 GCTGGTAGGAAGGCTCGGGTGGG + Intergenic
1130614448 15:85391594-85391616 GCTGCTGGGGAGGCTAAGGTGGG - Intronic
1130826063 15:87547516-87547538 GATGGTGGGGTGGTGGGGGTAGG + Intergenic
1130910363 15:88266406-88266428 GCAGGTGGCGGGGGGCGGGTGGG + Intergenic
1131187396 15:90286394-90286416 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
1131214883 15:90529075-90529097 GCTGGTCGGGAGGCTGAGGTGGG + Intergenic
1131324014 15:91424907-91424929 GCTGGTCAGGAGGTGTGGGTGGG - Intergenic
1131506584 15:93025181-93025203 GCTGATGGGGAGTGGCGAGTTGG + Exonic
1131520409 15:93109973-93109995 ACTGGTGGGGACGCCCGGGGAGG + Intergenic
1132519917 16:382154-382176 GCTGGAGGGAGGGCGCGGGATGG + Intronic
1132588788 16:717395-717417 GGTGCTGGGGAGGGGCTGGTAGG + Exonic
1132748695 16:1447479-1447501 GATGGGTGGGAAGCGCGGGTAGG + Exonic
1132771556 16:1566571-1566593 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1132894386 16:2221254-2221276 GCTGGCAGGGAGGGGCGGATGGG + Intergenic
1132935138 16:2475970-2475992 GGTGGTGTGGAGGTGCAGGTGGG + Intronic
1133068253 16:3226162-3226184 GCTACTGGGGAGGCTCAGGTAGG - Intronic
1133125104 16:3641462-3641484 GCTGGTGGGGAGTCTGGGGCAGG + Intronic
1133214939 16:4286343-4286365 GCTGGTTGGGAGCTGCTGGTTGG + Intergenic
1133787920 16:8987281-8987303 GCTAGTTGGGAGGCTCAGGTGGG - Intergenic
1133813375 16:9178107-9178129 GCAGGTGGGGAGGCGGAGGAGGG + Intergenic
1133834878 16:9358977-9358999 GCTACTGGGGAGGCTGGGGTGGG - Intergenic
1134485535 16:14655543-14655565 GCTGCTGGTGAGGCTGGGGTAGG - Intronic
1134846746 16:17446986-17447008 GATGGAGGGGAGGAGGGGGTGGG - Intronic
1135396125 16:22132878-22132900 GCTGGTGGGGAAGAGAAGGTAGG - Exonic
1135955074 16:26949530-26949552 GCTGCTTGGGAGGCTTGGGTGGG + Intergenic
1136610042 16:31360629-31360651 GCTACTGGGGAGGCTGGGGTGGG - Intronic
1137405888 16:48189034-48189056 GCTGGTGGGGTAGTGAGGGTTGG + Intronic
1138476205 16:57271953-57271975 GGTGCTGGGGAGGCTTGGGTAGG - Intronic
1139403655 16:66701441-66701463 GCTGCTTGGGAGGCTCAGGTGGG + Intergenic
1139795705 16:69481548-69481570 GCTACTGGGGAGGCTGGGGTGGG - Intergenic
1140932571 16:79641192-79641214 GCTGGTGGAGAGGGTCGGGGAGG + Intergenic
1140983076 16:80129267-80129289 GGAGGTGGGGAGGCCAGGGTCGG + Intergenic
1141358192 16:83369528-83369550 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1141624235 16:85253066-85253088 GCTGGTGGGGGGGGGGGGGTGGG - Intergenic
1141667044 16:85470995-85471017 GCTGGTGGGGAGGAGGGCGCTGG + Intergenic
1141822124 16:86453700-86453722 GGTGATGGGGAGGTGGGGGTGGG - Intergenic
1142000008 16:87658823-87658845 GCTGGTGCTGAGGCAGGGGTGGG + Intronic
1142009195 16:87705172-87705194 GCTGCTGGCGCGGCGCGGCTGGG - Intronic
1142062329 16:88038465-88038487 GGGGGTGGGGTGGCGGGGGTGGG - Intronic
1142099624 16:88264473-88264495 ACAGGTGGGGAGGCTGGGGTGGG - Intergenic
1142233829 16:88912140-88912162 TGGGTTGGGGAGGCGCGGGTGGG - Intronic
1142301312 16:89260021-89260043 GCTCTTTGGGAGGCGCAGGTGGG + Intergenic
1142475972 17:190209-190231 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
1142482612 17:228104-228126 GCTGGAGGGGAGCCTGGGGTGGG + Intronic
1142637235 17:1265548-1265570 GCTGCTGGGGAGGCTGAGGTAGG - Intergenic
1142673677 17:1500057-1500079 GCTGGTCAGGAGGCGGAGGTGGG - Intronic
1142717406 17:1754683-1754705 GGTGGGGGGGGGGCGCGGCTGGG + Exonic
1142752636 17:1998034-1998056 CCTGGGGCGGAGGCGGGGGTGGG - Intronic
1142874401 17:2842800-2842822 GCTGGAGGGGAGGAGAGGGTGGG - Intronic
1142983468 17:3684488-3684510 GCTAGTGGGGAGGCTGAGGTGGG + Intronic
1143015880 17:3890970-3890992 GCTGGTGTGGAGGATGGGGTAGG - Intronic
1143246033 17:5486379-5486401 GCTGGTGGAGAAGAGAGGGTGGG - Exonic
1143397169 17:6610006-6610028 GCTGGTGGGGATGTGGGGTTTGG + Exonic
1143443914 17:6996192-6996214 GCTGGTCGGGACGCGCGGGGAGG + Exonic
1143487260 17:7261756-7261778 GGTGGCGGGGTGGCGCGCGTGGG - Intronic
1143513136 17:7406640-7406662 GCTGGTGGGGGGGCGGGGGGGGG + Intronic
1143683258 17:8493230-8493252 GCTACTGGGGAGGCTCAGGTGGG + Intronic
1144115774 17:12089021-12089043 GCTGCTGGGGAGGCTGAGGTAGG - Intronic
1144481033 17:15629077-15629099 CCTGCTGGGGAGGTCCGGGTAGG + Exonic
1144917332 17:18734976-18734998 CCTGCTGGGGAGGTCCGGGTAGG - Exonic
1145015154 17:19391790-19391812 GGTGGGGGGGAGGGGCGGGAGGG - Intergenic
1146328054 17:31904077-31904099 GCTACTTGGGAGGCGGGGGTGGG - Intergenic
1147153921 17:38533742-38533764 GCAGATGGGGAGGTGGGGGTGGG + Intronic
1147330016 17:39692948-39692970 GCTGGTTGGGAGGCTGAGGTGGG + Intronic
1147337980 17:39738521-39738543 GCGGGTGGGGAGGAGGGGGCAGG - Intronic
1147364792 17:39952798-39952820 GCTGGGGTGGAGGCGGGGCTGGG + Intergenic
1147364844 17:39952956-39952978 GCTGGTGCGGAGGCGGGGTTGGG + Intergenic
1147426106 17:40346633-40346655 GCTGCTGGGGGGGCGGGGTTGGG - Intronic
1147741039 17:42671097-42671119 GCTGGTGGGGCGGCTGGGCTTGG - Exonic
1148796663 17:50200399-50200421 GCAGGTGGGGTGGCGGGGGCGGG + Intronic
1148819794 17:50353873-50353895 GCAGCTGGGGAGGCGCTGGTAGG + Exonic
1148856446 17:50581544-50581566 GATGGTGGGGTAGCGCAGGTTGG - Intronic
1148857192 17:50585255-50585277 GCTACTGGGGAGGCTGGGGTGGG - Intronic
1149502791 17:57167187-57167209 GGTGGTGGGGAAGGGGGGGTGGG + Intergenic
1149685325 17:58531657-58531679 GCTGGTGGAGACGCGCTTGTTGG - Intronic
1149916638 17:60615296-60615318 GCTGCTTGGGAGGCCCAGGTGGG + Intronic
1150597408 17:66618241-66618263 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
1150678488 17:67265117-67265139 GCTAGTGGGGAGGCAAAGGTGGG + Intergenic
1150930681 17:69581482-69581504 GCTGGAGGGAAGGCGTGGGGAGG - Intergenic
1151130618 17:71893106-71893128 GCTGGTGGGGGGTGGGGGGTGGG + Intergenic
1151190163 17:72392537-72392559 GCTGGTGGGGACGTGGGGGATGG + Intergenic
1151224967 17:72640997-72641019 GCTGCTGGCGAGGCGCGTGGGGG + Intergenic
1151370949 17:73645611-73645633 ATTGGTGGGGAGGCGGCGGTTGG + Intergenic
1151495900 17:74457877-74457899 TCTGGTGGGGAGGCGAGGGGTGG + Intergenic
1151833441 17:76569078-76569100 GGTGGTGGGGGGGCGGGGGAAGG + Intronic
1151856688 17:76726798-76726820 GCGGGAGGGGAGGGGCGGGGCGG - Intronic
1152238867 17:79151648-79151670 GGAGGAGGGGAGGCGAGGGTGGG + Intronic
1152238944 17:79151829-79151851 GGAGGAGGGGAGGCGAGGGTGGG + Intronic
1152388412 17:79988897-79988919 GCCGGCGGGCAGGTGCGGGTTGG - Intronic
1152461691 17:80445239-80445261 GCTGGTGGGGAGGGGCTGCAGGG + Intergenic
1152798403 17:82320003-82320025 GCCGGTGCGGAGACACGGGTGGG + Intergenic
1152846135 17:82600842-82600864 GGTGGTGGGGGGGCGAGGGCAGG + Intronic
1152861336 17:82698374-82698396 GCTGGGGAGGGGGTGCGGGTGGG - Intronic
1153209326 18:2742786-2742808 GCTAGTTGGGAGGCTCTGGTGGG - Intronic
1153488873 18:5628925-5628947 GCTGGCGGGGAAGCGCGGCGCGG - Intronic
1154194330 18:12254633-12254655 GAGGGTGAGGAGGCGCGGGACGG - Intronic
1154345691 18:13541962-13541984 GCTACTGGGGAGGCTGGGGTGGG + Intronic
1154386020 18:13892418-13892440 GCCGGTGGGGAGGGACGGGTAGG - Intronic
1154390483 18:13932375-13932397 GCTCCTGGGGAGGTGGGGGTCGG + Intergenic
1155046202 18:22105575-22105597 GCTGTTTGGGAGGCGGAGGTGGG - Intergenic
1155466535 18:26142149-26142171 GCTGCTGGGGAGGCTGAGGTAGG - Intronic
1156409880 18:36817545-36817567 GCTATTGGGGAGGCTGGGGTGGG - Intronic
1156459365 18:37313028-37313050 GCAGGTGGGCAGGTGAGGGTGGG + Intronic
1157591494 18:48838898-48838920 GCTGGTGGGCAGGCCCGGGGAGG - Intronic
1157618247 18:49000638-49000660 GCTAGTTGGGAGGCTGGGGTGGG - Intergenic
1158169864 18:54585688-54585710 GCTGGTGAGGAGCAGCAGGTAGG - Intergenic
1158434638 18:57427705-57427727 GATGGTGGGGCCGCGCCGGTCGG - Intergenic
1158506560 18:58051144-58051166 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
1158601847 18:58863235-58863257 GCTGGTGAGGGGGCGCAGGGAGG - Intronic
1158874796 18:61723220-61723242 GGGGGTGGGGAGGCGCAGGGAGG - Intergenic
1158953792 18:62522342-62522364 GCAGGTGGGGACGCGCGGCCGGG - Intergenic
1159179673 18:64886289-64886311 GCCGGTGGGGGGGTGCGGGGAGG - Intergenic
1159746568 18:72243231-72243253 TCTGGTGGGGAGGGGTGGATGGG - Intergenic
1159974328 18:74691980-74692002 GCTGCTAGGGAGGCTAGGGTGGG + Intronic
1160024568 18:75207611-75207633 GATTGTGTGGAGGCGGGGGTGGG - Intronic
1160130779 18:76223133-76223155 ACTGGTGAGGAGGCTCGGTTGGG + Intergenic
1160693566 19:471552-471574 GCTGCTGGGGAGGCCCAGGCAGG - Intronic
1160703144 19:517826-517848 GCTGGTGGGGAGGGGAGGCCCGG + Intronic
1160703283 19:518174-518196 GCTGGTGGGGTGGGGAGGGGAGG + Intronic
1160703351 19:518339-518361 GCTGGTGGGGTGGGGAGGGGAGG + Intronic
1160773588 19:844428-844450 GCCGGGGGAGAGGCGCGGGCAGG - Intronic
1160823338 19:1068153-1068175 GCCTGCGGGGAGGCGCGGGAGGG - Intronic
1160946103 19:1644801-1644823 CCTGGTGGGGAGGGTGGGGTGGG - Intronic
1160957339 19:1699690-1699712 GCCGCTGGGGAGGGGAGGGTGGG + Intergenic
1161261002 19:3337664-3337686 GATGGTGGGGAGGTTCGTGTTGG - Intergenic
1161269236 19:3380741-3380763 GCTAGTTGGGAGGCTGGGGTGGG - Intronic
1161294241 19:3511657-3511679 GTTGGTGGGGAGGCGTCGGCTGG + Intronic
1161453301 19:4358359-4358381 GCAGGTGGGGAGGTGAGGGAGGG - Intronic
1161499631 19:4606881-4606903 GGTGGTGGGGGGGCGGGGGTGGG - Intergenic
1161775144 19:6257259-6257281 GCTAGTTGGGAGGCTGGGGTGGG + Intronic
1161885588 19:6992752-6992774 GCTGCTGGGGAGGCTGAGGTAGG - Intergenic
1161994082 19:7701864-7701886 GGTGGTGAGGGGGCGGGGGTGGG - Intronic
1162013212 19:7830378-7830400 GCAGGTAGGGCGGCGCGGGCCGG + Intronic
1162126859 19:8504072-8504094 GCTGCTTGGGAGGCTGGGGTGGG + Intergenic
1162535583 19:11261700-11261722 GCTGGTGGGCAGACGGGGGAGGG - Intronic
1162939586 19:14000684-14000706 GCTGCTCGGGAGGCTGGGGTGGG + Intronic
1162987067 19:14277616-14277638 GCTTGTGGGGAGGTGCGGACTGG + Intergenic
1163102579 19:15107339-15107361 GCGGGCGGGGAGGCCCGGGCGGG + Intergenic
1163424957 19:17236098-17236120 GCGGGAGGGGAGGCGGGGGGGGG + Intronic
1163425033 19:17236301-17236323 GCAGGTGGGGGGGGGCAGGTAGG + Intronic
1163525364 19:17817681-17817703 GCTACTGGGGAGGCTGGGGTGGG + Intronic
1163847855 19:19647332-19647354 GGTGGTGGGGAGGCAGGTGTGGG + Intronic
1164547854 19:29183994-29184016 AGTGGTGGGGAGACGAGGGTAGG - Intergenic
1164692573 19:30222353-30222375 CCTGGTGGGGTGGGGCTGGTGGG + Intergenic
1164832967 19:31336744-31336766 GCTGGTGAGGAGGCACAGGCTGG - Intronic
1164989572 19:32674669-32674691 GCTGGAGGGGAGCGGCGGGTGGG - Intronic
1165166612 19:33861504-33861526 GCTAGTGGGGAGGCTGGGATGGG + Intergenic
1165548917 19:36566575-36566597 GCTGTTGGGGAGGTGGGGGGCGG + Intronic
1165609747 19:37141102-37141124 GCATGTGGGGAGGCCAGGGTGGG + Intronic
1165770306 19:38376138-38376160 GCTGATGGGGAGGGGAGGGAGGG - Exonic
1165822961 19:38688457-38688479 GCTAGTGGGGAGGCTGAGGTGGG + Intronic
1166041666 19:40206462-40206484 GCTAGTGGGGAGGCTGAGGTGGG + Intronic
1166042862 19:40213845-40213867 GGCCGTGGGGACGCGCGGGTGGG - Exonic
1166225538 19:41392793-41392815 GCTGGTAGGGAGGAGCTGGGGGG + Intronic
1166381898 19:42359076-42359098 GCTGTTGGGGAGACGGGGGGTGG - Exonic
1166409170 19:42544858-42544880 GCTGGGGGGGGGGCGGGGGGTGG + Intronic
1166769507 19:45272516-45272538 GCTGGGGGGGAGGAGCAAGTTGG + Intronic
1166834399 19:45658378-45658400 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
1167105813 19:47429540-47429562 CCCGGCGGGGAGGAGCGGGTGGG - Exonic
1167502513 19:49855932-49855954 GCTGGAGAGGAGGCAGGGGTGGG + Intronic
1168315191 19:55481985-55482007 GCGGGGCGGGAGGCGCGGGCGGG - Exonic
1168404329 19:56102994-56103016 GCGGGAGGGGAGGCCAGGGTCGG + Intronic
1168405356 19:56107714-56107736 TCTGTTGGGGAGGCTGGGGTGGG + Intronic
1168408069 19:56121020-56121042 GCTGCTGGGGGGGCGTGAGTGGG - Intronic
1168554520 19:57326860-57326882 GCGGGTGGGGGGGGGCGGGCGGG - Intronic
924992231 2:322062-322084 GCAGGTGGGGAGGAGCAGGAGGG + Intergenic
925188459 2:1865057-1865079 TCTTGTGGGGAGGCGGGGGAAGG + Intronic
925572699 2:5328990-5329012 ACTGGTTGGGAGGAGCGGGGAGG + Intergenic
925776401 2:7340119-7340141 GCTGGGGAGGAGGCACTGGTGGG + Intergenic
925936841 2:8772039-8772061 TCTGGTGGGAAGGCACGGGCTGG + Intronic
926098345 2:10097407-10097429 GCTGGTTTGGAGGCGAGGGCAGG - Intergenic
926151555 2:10428417-10428439 GCTGGTGGGGACGGGGTGGTGGG - Intergenic
927281336 2:21311318-21311340 GCTGGTGGGGAGGCTGAGGCAGG - Intergenic
927508007 2:23627038-23627060 GGTGCTGGGGAGGAGCGGGGCGG - Intronic
927557494 2:24046106-24046128 CCTGTTGGGGAGGTGGGGGTGGG + Intronic
927792223 2:26019357-26019379 GCTGGTAGGGAGGCTGAGGTGGG - Intergenic
927809214 2:26172763-26172785 GCGGGAGGGGAGGCGGGGCTTGG + Intergenic
927883917 2:26706972-26706994 GCTGGAGGGGAGGCCAGGGCAGG - Intronic
927920837 2:26970889-26970911 GCGGGTGGGGAGGCAGGGGCGGG - Intronic
927935386 2:27072925-27072947 GCTGGTGGTGAGGTGCGGGGAGG - Intergenic
929679027 2:43969792-43969814 GCTGCTTGGGAGGCTGGGGTGGG - Intronic
929702999 2:44181054-44181076 GCTGCTTGGGAGGCTGGGGTAGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930872819 2:56184912-56184934 CCAGGTGGGGAGGCGCGGCGCGG + Intronic
931064464 2:58569939-58569961 GGTGGTGGGGCGGGGCGGGGAGG + Intergenic
931695547 2:64867985-64868007 GCTAGTGGGGAGGCTGAGGTGGG + Intergenic
932154641 2:69404864-69404886 GCTGTTTGGGAGGCGGAGGTAGG - Intronic
932415727 2:71572851-71572873 GCTGGTGAGGGGGCTGGGGTGGG + Intronic
932715930 2:74100838-74100860 GCTGGTGGTGAGGAGTGGGGTGG - Exonic
932760869 2:74438453-74438475 GCTGGTGGGAAGTTGAGGGTAGG - Intronic
933738828 2:85517010-85517032 GGGGGTGGGGGGGCGAGGGTCGG + Intergenic
933773560 2:85758658-85758680 GCAGGTGGGGAGGTGCAGGTGGG + Intronic
934559732 2:95306950-95306972 GCTGCTGGGGAGGCGGGAGGAGG - Intronic
934614168 2:95761162-95761184 ACAGCTGGGGAGGGGCGGGTGGG - Intergenic
934728100 2:96638125-96638147 GCTGGTCGGGCGGGGCGGGTCGG - Intronic
935283059 2:101535946-101535968 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
935584030 2:104784669-104784691 GCTGCTGGGGAGTGGCTGGTGGG - Intergenic
936370452 2:111898508-111898530 GCTGGAGGAGAGGAGCGGGCAGG - Exonic
936480479 2:112880459-112880481 GCTGCTGGGGAGGCTTGGGAAGG + Intergenic
937160938 2:119760190-119760212 GCTGCTGGGCAGCCGCGGGCCGG - Exonic
937309801 2:120895047-120895069 GCTGATGGGGAGGGGAGGGGAGG + Intronic
938065362 2:128279167-128279189 GCTGATGGGGGTGCGGGGGTGGG + Intronic
938802839 2:134778592-134778614 GGTGGTGGGGCGGGGCGGGGTGG - Intergenic
939976843 2:148728099-148728121 GCTGTTGGGGAGGCTCAGGCAGG - Intronic
940671029 2:156668149-156668171 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
940918875 2:159286517-159286539 GCAGGTGGGGAAGCGCGGCTGGG - Exonic
941009645 2:160285143-160285165 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
941021037 2:160407963-160407985 GCGGGCGGGGAGGCGCGGGTGGG - Intronic
942029730 2:171947500-171947522 GCTCTTTGGGAGGCGCAGGTGGG - Intronic
942456375 2:176140983-176141005 GCTGGTTGGGATCCGCGGATTGG - Intergenic
943247280 2:185472717-185472739 GCTGTGGGGGAGGCGCAGCTGGG + Intergenic
944057727 2:195540743-195540765 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
945314768 2:208359961-208359983 GCTGGGCGGGAGGAGCGGATGGG + Intronic
945891583 2:215436165-215436187 GCGGGTGGGGTGGGGCGGGGCGG - Exonic
946268469 2:218568892-218568914 GCTGAAGGGGGGACGCGGGTCGG + Exonic
947658717 2:231850421-231850443 GCTGGGTGGGAGGCTCAGGTGGG + Intergenic
948116176 2:235495268-235495290 GCTGGGGGCGAGGCCCGGGCCGG + Intronic
948984658 2:241513163-241513185 GCTAGTTGGGAGGCTCAGGTGGG + Intergenic
1168760803 20:348165-348187 GGCGCTGGGGAGGCCCGGGTGGG - Intronic
1168878217 20:1185429-1185451 GCCGCTGGGGAGGCGGGGGGGGG + Intronic
1169130152 20:3162565-3162587 GCGGGAGGTGAGGCCCGGGTGGG - Intergenic
1169139394 20:3218506-3218528 GCTGGTGGAGACCTGCGGGTGGG - Exonic
1169164208 20:3407998-3408020 GCTGGTCGGGCGGGGCGGGGCGG - Intergenic
1170424296 20:16223337-16223359 GCTGCTGGGGAGGCTCAGGCAGG - Intergenic
1170619123 20:17979519-17979541 GCTGCTGGGGAGGCTGAGGTAGG - Intronic
1171037737 20:21729361-21729383 GGTGCTGGGGAGGAGCGGGGAGG + Intergenic
1172100450 20:32481949-32481971 GTTGGTGGGGCGGGGCGGGGGGG + Intronic
1172125111 20:32621101-32621123 GTTGGTGGGGAGGCTGGGGTGGG + Intergenic
1172520222 20:35561200-35561222 GGTGGTGGGGAGGGGTGGTTGGG - Intergenic
1173383745 20:42569566-42569588 GCTGGTGGAGAGGAGCAGGCAGG - Intronic
1173471094 20:43324145-43324167 GCTGCTTGGGAGGCTGGGGTGGG - Intergenic
1173633667 20:44535960-44535982 GCTGGTGGGGAGGCGGAAATGGG - Intronic
1173716823 20:45215171-45215193 GCTGGTCGGGAGGCGGTGGGGGG + Intergenic
1174027535 20:47590697-47590719 GCTGCTGGGGAGGCTGAGGTAGG + Intronic
1175504660 20:59473033-59473055 TCTGGTGGGCAGGGGCGGGGCGG + Intergenic
1175937477 20:62520441-62520463 GCTACTGGGGAGGCTGGGGTGGG + Intergenic
1175970665 20:62685166-62685188 GGTGGTGGGGAGGCACGGGCAGG + Intronic
1175995814 20:62811948-62811970 CCTGGTGGGGAGGAGCTGGCTGG - Intronic
1176012692 20:62908089-62908111 GCTACTGGGGAGGCTGGGGTGGG - Intronic
1176062173 20:63177249-63177271 GCTGGAGGGGCTGCGCGCGTGGG + Intergenic
1176207173 20:63895377-63895399 GCGGGCGGGCGGGCGCGGGTGGG + Intronic
1176215264 20:63944863-63944885 GCAGGTGGGGAGGAGTGGGGAGG + Intronic
1176264518 20:64202143-64202165 GCTGGTGGGGAGGCGAGCTGGGG - Intronic
1177780289 21:25614965-25614987 GATGGTGGGGAGGGGAGGGAAGG - Intergenic
1178161855 21:29927099-29927121 GCTGGTGGTGTGGAGCGGGGAGG - Intronic
1178184866 21:30207885-30207907 ACTGGTGGGGAGGAGGGGGATGG + Intergenic
1178418772 21:32426511-32426533 GCTGGTGGGGTGGCAGGGGTTGG - Intronic
1178930003 21:36809848-36809870 GCTACTGGGGAGGCTCAGGTGGG - Intronic
1179104123 21:38383436-38383458 GCTGGTGGGGAGCCTAGTGTTGG + Exonic
1179509263 21:41861664-41861686 GCTGCTGGGGATGAGCGGGGTGG - Exonic
1180041649 21:45283273-45283295 GGTGGTGGGGAGGAGTGGGCGGG + Intronic
1180067172 21:45418299-45418321 GCTGGCGGGCAGGCGTGGGAAGG - Intronic
1180094779 21:45550915-45550937 GGTTGTGGGGAGGCGGGGGGAGG - Intergenic
1180156645 21:45981582-45981604 GCGGGAGGGGAGGGGCGGGGCGG - Intergenic
1180156656 21:45981601-45981623 GCGGGAGGGGAGGGGCGGGGCGG - Intergenic
1180956987 22:19745627-19745649 GCAGGCTGGGAGGCGCGGGCCGG + Intergenic
1181065421 22:20303455-20303477 CCTGGTGGGGAGGAGGAGGTCGG + Intergenic
1181133020 22:20745238-20745260 GCTGGAGGGGTGGAGTGGGTGGG - Intronic
1181162039 22:20965133-20965155 GGGGGCGGGGAGGCGCGGGCGGG - Exonic
1181235451 22:21445556-21445578 GCTGGCGGGGAGGCGGGTCTGGG + Exonic
1181646502 22:24234040-24234062 CCTGGTGGGGAGGCAGGGGGAGG - Intronic
1181778830 22:25178503-25178525 CCTGGTGGGGAGGGGCGGCGGGG + Intronic
1182728600 22:32469161-32469183 GCTGCTGGGGAGGCTGAGGTAGG + Intergenic
1182766220 22:32760100-32760122 GCTGGTGGGTGGGCGCTGGCTGG - Intronic
1182791845 22:32959704-32959726 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1183188512 22:36306382-36306404 CCTGGTGGGGTGGCCCGGGCAGG - Intronic
1183269461 22:36851529-36851551 GCTGGAGGGAGGGTGCGGGTGGG + Intergenic
1183454088 22:37912131-37912153 GCTGGTGGGAAGCAGAGGGTGGG - Intronic
1183710171 22:39498647-39498669 GGGGGTGGGGAGGAGGGGGTGGG + Intergenic
1183727700 22:39598577-39598599 GCTGGTGGGGGCACCCGGGTAGG - Intronic
1184171785 22:42764346-42764368 GCGGGTGGGGAGGTGGGAGTGGG + Intergenic
1184207469 22:43014512-43014534 GCTGGAGGGAAGGCGTGGCTGGG - Intronic
1184566050 22:45292794-45292816 GCTGCTTGGGAGGCTGGGGTGGG + Intronic
1185033374 22:48457700-48457722 GGTGGAGGGGAGGCGGTGGTGGG + Intergenic
1185317873 22:50186491-50186513 CCTCGCGGGAAGGCGCGGGTCGG + Intronic
1185342922 22:50299663-50299685 GCCCGTGGGTAGGCGCGGGGAGG + Intronic
949969995 3:9396740-9396762 GGTGGCGGGGAGGCGGGCGTTGG - Intergenic
950008298 3:9705063-9705085 GCCGGAGGCGAGGCGGGGGTGGG - Intronic
950074105 3:10174977-10174999 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
950091789 3:10300893-10300915 GCTGGTGGGGTGGGGTGGTTAGG + Intronic
950282323 3:11719259-11719281 GCCGCTCGGGAGGCGCCGGTGGG - Intronic
950406847 3:12810235-12810257 GCTGGTGGGCACCCGCGGGCCGG - Exonic
950443377 3:13022597-13022619 GCGGGCGGGGAGGCGAGGGCGGG + Intronic
950642179 3:14355459-14355481 GCTACTGGGGAGGCTCAGGTGGG - Intergenic
950652668 3:14416954-14416976 GCTGCTAGGGAGGCTGGGGTGGG - Intronic
950776977 3:15358515-15358537 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
951171759 3:19550500-19550522 GCTACTGGGGAGGCTGGGGTAGG - Intergenic
951565748 3:24011168-24011190 GCTGCTGGGGAGGCTAAGGTGGG - Intergenic
952115645 3:30177524-30177546 GGTGGTGGGGTGGGGCGGGCTGG + Intergenic
953406728 3:42663462-42663484 GCAGGTGGGGAGGTGGGGGCAGG + Intronic
953554332 3:43931417-43931439 GCAGGTGGGGAGACCTGGGTTGG - Intergenic
953618178 3:44510602-44510624 GCTGGGAGGTAGGCGCGGGGCGG - Exonic
954340005 3:49945768-49945790 GCTGCTGGGGAGGCTGGGGCAGG + Intronic
954614822 3:51964237-51964259 GCTGGGGGGGAGGGGCAGGAAGG - Intronic
954617099 3:51974685-51974707 GGGGGTGGGGAGGAGTGGGTAGG + Intronic
954618986 3:51985151-51985173 GCTGGTGGGAAGCTGTGGGTAGG + Intronic
954733482 3:52685624-52685646 GGCCGTGGGGACGCGCGGGTCGG - Intronic
954855907 3:53643306-53643328 GCTGGTGGGCAGGCAGGCGTCGG - Intronic
955081793 3:55664550-55664572 GGTGGTGGGGAGGAGGGGCTGGG + Intronic
955338191 3:58104297-58104319 GCTGGTGGTTAGGGGCTGGTGGG + Intronic
955656159 3:61247072-61247094 GCTGGTAGGGAGGCACTGATGGG - Intronic
955966671 3:64396056-64396078 GCTAGTGGGGAGGCTGGGGAGGG + Intronic
956741689 3:72280551-72280573 GCTACTGGGGAGGCTGGGGTGGG - Intergenic
956873841 3:73443062-73443084 GCCGGTGGTGGGGCGCGGCTGGG - Intronic
959888026 3:111524984-111525006 GCTGGTTTTGAGGCTCGGGTGGG + Intronic
960223723 3:115146905-115146927 GGTGGGAGGGAGGCGCGGGAGGG - Intronic
960960452 3:123067156-123067178 GCTGCTGGGATGGCGCGGGCCGG + Exonic
961474914 3:127140487-127140509 GCTGGTGCTGAGGCTGGGGTTGG + Intergenic
961477421 3:127157442-127157464 GGGGGTGGGGAGGGGCAGGTCGG + Intergenic
961686916 3:128639697-128639719 GCTACTGGGGAGGCTCAGGTAGG - Intronic
962174167 3:133135463-133135485 GCTGGAGCTTAGGCGCGGGTTGG + Intronic
962313139 3:134339879-134339901 CCTAGTGGTGAGGCGGGGGTGGG - Intergenic
963821770 3:149904490-149904512 GCTGCTGGGGAGGCTAAGGTAGG - Intronic
963867693 3:150379868-150379890 GGTGGTGGTGAGGTGGGGGTTGG - Intergenic
965132420 3:164718348-164718370 GCTACTGGGGAGGCTCAGGTAGG - Intergenic
965648389 3:170908502-170908524 GCTGGTGGGGAAAAGCTGGTGGG - Intronic
965881995 3:173397633-173397655 GCAAGTGGGGAGCCGCGGGTGGG - Intronic
966284420 3:178277120-178277142 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
966500507 3:180634148-180634170 GCTGGTGGGGTGGGGTGGGGTGG - Intronic
966855059 3:184188192-184188214 GCTGGTGGGGCGGAATGGGTTGG + Exonic
966856093 3:184194727-184194749 GCTGTTGGGGAGGCCAAGGTGGG + Intronic
967681617 3:192370429-192370451 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
967814418 3:193787159-193787181 GTGGGTGGGGAGGTGGGGGTTGG + Intergenic
967858384 3:194134657-194134679 GAGGGTGGGGAGGCGGGGGTTGG + Intergenic
968077738 3:195825550-195825572 GCTGCAGGGGAGGCGAGGCTGGG - Intergenic
968092735 3:195908886-195908908 GCTGGTGGGGAGGGCCCGGCCGG - Intronic
968148355 3:196318298-196318320 GCCGGTGCGCAGGCGCGGGCAGG - Intronic
968166206 3:196467268-196467290 GCTGCTGGGGAGGCTCAGGCCGG - Intergenic
968741784 4:2334851-2334873 GCTGGGGGGGAGGCGGAAGTGGG - Intronic
969057903 4:4413602-4413624 GCTGGTGGGGGTGTGCTGGTGGG + Intronic
969344935 4:6564331-6564353 CCCGGTGGGGGGGCGGGGGTGGG - Intergenic
969614093 4:8242337-8242359 CCTGGTGGGGAAGCTCGGGGCGG - Intergenic
971366026 4:25977813-25977835 GGAGGTGGGGAGGCGCAGGGAGG - Intergenic
971624791 4:28905508-28905530 GTTGGTGGGAAGGCAAGGGTGGG + Intergenic
971645041 4:29188831-29188853 GCTAGTGGGGAGGCTGAGGTGGG - Intergenic
971874606 4:32290698-32290720 GCTATTGGGGAGGCCCAGGTGGG - Intergenic
972476552 4:39455657-39455679 GCTAGTGGGGAGGCTGAGGTGGG + Intronic
974356995 4:60825345-60825367 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
976139089 4:81971658-81971680 GGTGGTAGGGGGGCGGGGGTGGG + Intronic
976220665 4:82754519-82754541 GCTGCTGGTGAGGGGAGGGTGGG - Intronic
978350440 4:107815777-107815799 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
978659532 4:111108188-111108210 GCTGGAGGGGAGGCATGGCTTGG + Intergenic
979915739 4:126431283-126431305 GCTGGTGGGGTGGTGAGGGAGGG + Intergenic
980930175 4:139177144-139177166 GTCGGTGGGGCGGCGCGGGCGGG - Exonic
980936519 4:139231321-139231343 GCTGCTGGGGAGGCTAAGGTGGG - Intergenic
981213342 4:142134683-142134705 GCTGGTTGGGAGGCTGAGGTGGG + Intronic
982239689 4:153286756-153286778 GATGGTGGGGGGGTGCGGGGTGG - Intronic
982691540 4:158553075-158553097 GCTGCTTGGGAGGCTGGGGTGGG + Intronic
982862444 4:160470173-160470195 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
983209126 4:164940823-164940845 GCTACTGGGGAGGCTCTGGTAGG + Intergenic
983584041 4:169337231-169337253 GCTACTGGGGAGGCTCGGGCAGG - Intergenic
984935317 4:184884396-184884418 GAGGGTGGGGAGGCGGGGATGGG + Intergenic
985372732 4:189303328-189303350 GCTGGTGGGGAGGCTGAGGCAGG - Intergenic
985478409 5:92335-92357 GCGGGTGGGGGCGCGGGGGTAGG + Intergenic
985478438 5:92388-92410 GCGGGTGGGGGCGCGGGGGTAGG + Intergenic
985478477 5:92471-92493 GCGGGTGGGGGCGCGGGGGTAGG + Intergenic
985490194 5:174448-174470 GCTGGGGTGGAGGCATGGGTTGG + Intronic
985498439 5:224787-224809 GGTGTTGGGGTGGCGGGGGTAGG - Intronic
985529266 5:424236-424258 TCTGGTGGGGGGGCGAGGGCCGG + Intronic
985529306 5:424385-424407 CCTGGTGGGGGGGCGAGGGCCGG + Intronic
985531188 5:434618-434640 GCTGGTGGGGAGGCTCCGACTGG - Exonic
985595203 5:784816-784838 CCTGGTGGGGCGGCGGGGGCGGG - Intergenic
985619723 5:947922-947944 GGTGGAGGGGTGGCGGGGGTGGG - Intergenic
985702222 5:1380511-1380533 GCTGGCGGAGAGGCGCGGGCGGG - Intergenic
985783076 5:1881055-1881077 GCCGGTGGGGGGGGGCGGGGGGG + Intronic
986199781 5:5570288-5570310 GCTGGTGGGGAAGTTCGGCTGGG + Intergenic
986333814 5:6737996-6738018 GGTGGTGGGGAAGCAGGGGTGGG - Intronic
987286446 5:16462539-16462561 GCTGCTGGGGAGGCTGTGGTGGG + Intronic
987295427 5:16546277-16546299 GCTGCTTGGGAGGCTGGGGTGGG - Intronic
987320931 5:16768785-16768807 GCTGCTTGGGAGGAGAGGGTGGG - Intronic
987367232 5:17159644-17159666 GCTGCTGGGGAGACGAGGCTAGG + Intronic
988663720 5:33301797-33301819 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
990080295 5:51904226-51904248 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
992906067 5:81347227-81347249 GCTAGTTGGGAGGCGGAGGTGGG - Intronic
993009529 5:82464274-82464296 GCTGGTTGGGAGGCTGAGGTGGG + Intergenic
993236211 5:85313602-85313624 GCTGCTCGGGAGGCTGGGGTGGG - Intergenic
995022031 5:107377837-107377859 GCTGGTGGAGAAGGGAGGGTGGG + Exonic
995553886 5:113308082-113308104 GCTATTGGGGAGGCTCAGGTGGG - Intronic
996487821 5:124057412-124057434 GCGGGTAGGGAGGCACTGGTGGG + Intergenic
996828424 5:127712028-127712050 GCAGGTGGGGAGAGGCAGGTGGG - Intergenic
997033492 5:130159274-130159296 GCTAGTTGGGAGGCTGGGGTGGG - Intronic
997299738 5:132794069-132794091 GCTGGTTGGGAGGCTGAGGTGGG - Intronic
997634949 5:135398470-135398492 GCTGGTGCGGGGGACCGGGTTGG - Intronic
998092804 5:139380910-139380932 AGGGGTGGGGAGGGGCGGGTGGG + Intronic
998126343 5:139625167-139625189 GCTACTGGGGAGGCTGGGGTGGG - Intronic
998247873 5:140525372-140525394 GCTACTGGGGAGGCTGGGGTGGG - Intronic
998568926 5:143239849-143239871 GCTGGGGCGGGGGCGGGGGTGGG - Intergenic
999044024 5:148448323-148448345 AGTGGTGGGGGGGCGGGGGTGGG - Intergenic
999552835 5:152708170-152708192 GCTGGTGGGGAGGGTCAAGTGGG - Intergenic
999873517 5:155776637-155776659 GCTGGAGGTGGGGCGGGGGTGGG - Intergenic
1001226467 5:169948722-169948744 GCTGGTTGGGAGGCTGAGGTGGG - Intronic
1001392290 5:171388525-171388547 GGGGGTGGGGAGGCGCGGCGCGG + Intronic
1001398884 5:171435133-171435155 GCTGGTGGGGAGGGAGTGGTGGG + Intronic
1001424879 5:171616403-171616425 GCTGTGGGGGAGGGGCGTGTGGG + Intergenic
1001992980 5:176133224-176133246 ACTGGTGGGGAGAAGCGTGTAGG + Intergenic
1002093401 5:176817565-176817587 GGGGGTGGGGAGGGGCGGGGTGG - Intronic
1002252717 5:177939515-177939537 GCTGCTGGGGAGGAGCCGGAAGG - Intergenic
1002368425 5:178730575-178730597 GCGGCTGGGGAGGCGCGGCCCGG - Exonic
1002415826 5:179120575-179120597 GCTGGGGTGGAGGGGCGGGGAGG + Intronic
1002471218 5:179437399-179437421 GCTGGTGGGGAGGCCTTGGGAGG - Intergenic
1002508161 5:179695159-179695181 GCTGCTGGGGAGGCTGGGGCAGG - Intronic
1002603807 5:180370332-180370354 GCTGCTGGGGAGGGGAGGGAGGG + Intergenic
1002634769 5:180601829-180601851 GGAGGTGGGGAGGGGAGGGTCGG + Exonic
1002888794 6:1317034-1317056 GCTGGGGGGGAGGCGGGAGGAGG - Intergenic
1003145245 6:3504864-3504886 GCTGGGGGGGAGGTGGGGGTTGG + Intergenic
1003162392 6:3647164-3647186 GCTTGAGGGGAGGTGTGGGTTGG - Intergenic
1003532961 6:6952876-6952898 GCGGGTTGGGGGGCGGGGGTTGG + Intergenic
1003942669 6:11044367-11044389 GGGGGCGGGGAGGCGCGGGCGGG - Intergenic
1004069845 6:12288309-12288331 GTTGGGGGGGAGGCGCTGCTTGG + Intergenic
1004145670 6:13063666-13063688 GCTGCTGGGGAGGCTAAGGTGGG + Intronic
1005353565 6:24960636-24960658 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1006107184 6:31723790-31723812 GCTGGAGGGGAGGCACGGTGGGG - Exonic
1006109567 6:31736451-31736473 GCTGGTGGGGAGGCCTAGTTTGG - Intronic
1006316189 6:33293209-33293231 GCTGGTGGGGAGAGGTGGCTGGG + Exonic
1006459105 6:34148044-34148066 GCTGGTGGGGGGCGGGGGGTGGG - Intronic
1006542145 6:34748950-34748972 GCTGCTTGGGAGGCTCAGGTGGG + Intergenic
1007324755 6:41051515-41051537 GCTGGTGGGGATGAGAGGGTAGG - Intronic
1007557977 6:42782639-42782661 GGTGGTGGGGAGGGGAGGGGAGG + Intronic
1007787892 6:44291903-44291925 GATGGTGGGGTGGGGCGGGAGGG - Intronic
1008556771 6:52679864-52679886 GGTGGTGGGGAGGGTGGGGTGGG + Intronic
1009415935 6:63416677-63416699 GCTGTTTGGGAGGCTGGGGTAGG - Intergenic
1012815718 6:104019281-104019303 GCTGTTGCTGAGGCGTGGGTGGG + Intergenic
1012939607 6:105402958-105402980 GCTGGCCGCGAGGCGCGGCTGGG + Exonic
1013117748 6:107115381-107115403 GCTGAGGGGGAGGGGCGGGCCGG - Intergenic
1013257214 6:108399730-108399752 GCTACTGGGGAGGCTGGGGTGGG + Intronic
1014075761 6:117232617-117232639 GCTTGTGGGGAGGTGAGGATGGG - Intergenic
1016844834 6:148559977-148559999 GCTCGCCGGGAGGCGCTGGTGGG + Intergenic
1016870072 6:148808012-148808034 GCCGGTGGGGAAGCCAGGGTGGG + Intronic
1017672096 6:156778154-156778176 GCTGGTGGGGCGGCGCGGCGGGG - Exonic
1018580798 6:165307207-165307229 GTTGGTGGGGTGGGGGGGGTGGG - Intronic
1019109683 6:169699868-169699890 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
1019424720 7:969128-969150 GCTGGGAGGGAGGCGAGCGTGGG - Exonic
1019476494 7:1247120-1247142 GCTGGTGGGGCGGCGGGGCGGGG + Intergenic
1019585355 7:1799080-1799102 GCTGGTCGGGAGGCTGAGGTGGG + Intergenic
1019599300 7:1873443-1873465 GGCGGTGGGGAGGGGCAGGTGGG + Intronic
1019625556 7:2014083-2014105 GCTGCTGGGGAGGCTCTGCTGGG - Intronic
1019633026 7:2059598-2059620 GCTGGTGGGGAAGCGTGGCCAGG + Intronic
1020051484 7:5084862-5084884 GCTACTTGGGAGGCGGGGGTGGG + Intergenic
1020262186 7:6536668-6536690 CCTGGTGGGGAGGGGCGGGACGG + Intronic
1020266120 7:6561213-6561235 GCTGCTCGGGAGGCTGGGGTGGG - Intergenic
1021231022 7:18086646-18086668 GCGGGCCGGGAGGCGCGGGCCGG - Intergenic
1021365331 7:19772214-19772236 GCTGTTTGGGAGGCGGGGGGAGG - Intronic
1021621790 7:22556199-22556221 GCTGTTGGGGAGGCTGAGGTAGG + Intronic
1021702912 7:23337779-23337801 GCTACTGGGGAGGCGGAGGTGGG - Intronic
1021890317 7:25180444-25180466 CCTGGGGGCGGGGCGCGGGTGGG - Intergenic
1022092058 7:27114083-27114105 GCGGCTGGGGAAGCGCGGGCTGG + Intronic
1022385617 7:29896195-29896217 GCTGCTGGGGAGGCTCAGGCAGG + Intronic
1023177482 7:37448294-37448316 GCGGGAGGGGGGGCGCGGGAGGG - Intronic
1023229296 7:38008800-38008822 GCTGCTTGGGAGGCTGGGGTGGG + Intronic
1023442054 7:40194370-40194392 GCTGCTCGGGAGGCTCAGGTGGG - Intronic
1023607145 7:41941468-41941490 GAGGGTGGGGAGCCGCGGCTGGG - Intergenic
1024026084 7:45411034-45411056 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
1024689462 7:51783310-51783332 ACTGTTGGGGAGGCAGGGGTGGG - Intergenic
1024726881 7:52207929-52207951 GCTGCTGGGGAGGCTCAGGCAGG + Intergenic
1025084209 7:56009529-56009551 GGTGGTGGGGCGGCAGGGGTGGG - Intergenic
1025174028 7:56787719-56787741 GCTGGGCGGGAGGCGGCGGTCGG - Intergenic
1025698073 7:63790236-63790258 GCTGGGCGGGAGGCGGCGGTCGG + Intergenic
1025854859 7:65267940-65267962 GCTGGTGGGGAGGGGGTGCTAGG + Intergenic
1025959063 7:66205009-66205031 GCTGCAGGGGAGCCGCGGGCAGG - Intergenic
1026548556 7:71346741-71346763 CCTGTTGGGGGGGCGGGGGTGGG + Intronic
1026707113 7:72703710-72703732 GCTGGTGTGGTGGCGCGCGCCGG + Intronic
1026796151 7:73367264-73367286 GCTGGCGGGAAGGCACGGGGTGG - Intergenic
1026941124 7:74288748-74288770 GCTACTGGGGAGGCTGGGGTGGG - Intergenic
1026968329 7:74454007-74454029 GCGGGGAGGGAGGCGCGGGGAGG - Exonic
1027189433 7:75988782-75988804 GCTGGAGGGGAAGGCCGGGTGGG + Intronic
1027428253 7:78083354-78083376 GATGGTGGGGGGGCGGGGGAGGG + Intronic
1029110468 7:98211141-98211163 GATGGTGGGGAGAGGCGGGCGGG + Intergenic
1029448273 7:100626905-100626927 TGGGGTGGGGAGGCGCGGGCTGG + Intronic
1029546295 7:101212220-101212242 GCTTGCGGGGAGGAGAGGGTGGG - Intronic
1030071401 7:105700791-105700813 GCTACTGGGGAGGCTGGGGTGGG - Intronic
1030121249 7:106112417-106112439 GCGGCTGGGGAGGCGAGGGGCGG + Intronic
1031479530 7:122261417-122261439 GTTGGTGAGGAGGTGGGGGTGGG + Intergenic
1031899337 7:127392470-127392492 GCAGGTGGAGCGGCGCTGGTGGG - Exonic
1032279924 7:130492031-130492053 GCTAGGGGCGGGGCGCGGGTGGG + Intronic
1033115238 7:138619294-138619316 GCTACTGGGGAGGCTCAGGTGGG + Intronic
1033514276 7:142090678-142090700 GCTGGTGAGGAGGTTCGGGGAGG - Intronic
1034242650 7:149622199-149622221 GCTTGTGGGGAGGGGCAGATGGG - Intergenic
1034425918 7:151013915-151013937 GCGGGTGCGGAGGGGCGGGCCGG + Exonic
1034435049 7:151059531-151059553 GCGGGTGGGGAGGCGGGAGCGGG - Intronic
1034448354 7:151124734-151124756 GCTTGTGGGGAGGGGCCAGTCGG + Intronic
1034512104 7:151544147-151544169 GCTAGTGGGGAGGCTGAGGTGGG - Intergenic
1035023244 7:155810756-155810778 GCTGATGGAGTGGCGCTGGTGGG - Intronic
1035203736 7:157281689-157281711 GCAGGAGGGGAGGCCAGGGTGGG + Intergenic
1035728800 8:1840862-1840884 GCTGCTGGGGTGGAGAGGGTGGG + Intronic
1036257714 8:7218830-7218852 TATGGTGGGGAGGTGGGGGTGGG - Intergenic
1036309763 8:7677426-7677448 TATGGTGGGGAGGTGGGGGTGGG - Intergenic
1036359773 8:8068693-8068715 TATGGTGGGGAGGTGGGGGTGGG + Intergenic
1036402467 8:8422236-8422258 GCTACTGGGGAGGCTGGGGTGGG + Intergenic
1036891187 8:12598277-12598299 TATGGTGGGGAGGTGGGGGTGGG - Intergenic
1036944648 8:13083089-13083111 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
1037115278 8:15217972-15217994 GCTGCTGGGGAGGCCGAGGTAGG + Intronic
1037317070 8:17609107-17609129 GCTGCTTGGGAGGCTGGGGTGGG + Intronic
1037485353 8:19341729-19341751 GCTGCTTGGGAGGCTGGGGTGGG + Intronic
1037486302 8:19350593-19350615 GCTACTCGGGAGGCGAGGGTGGG - Intronic
1037768801 8:21787372-21787394 GCTGGTGGGAAGAGGCGGGAGGG - Intronic
1037804062 8:22049573-22049595 CCTGGTGGGGTGGCGGGGGGGGG - Intronic
1037820571 8:22132885-22132907 GCTCGTGGGGACTCGCGGGATGG + Intronic
1037827032 8:22165584-22165606 CCAGGCGGGGAGGCGCGGGCGGG + Intronic
1037925297 8:22839415-22839437 GCTGGTGGGGAGGCAGAGGCTGG + Intronic
1038296172 8:26292077-26292099 GCTTGGGGTGAGGCGTGGGTGGG + Intronic
1038436410 8:27539774-27539796 CCTGGTGGGGAGGCTCAGGGTGG + Intronic
1038498745 8:28025881-28025903 GCTGGAGGGTAGGAGAGGGTGGG - Intronic
1038547501 8:28436861-28436883 GCTACTGGGGAGGCTCAGGTGGG - Intronic
1038647084 8:29370892-29370914 GCTACTGGGGAGGCTGGGGTGGG + Intergenic
1038828739 8:31033772-31033794 GCTGGAGGGGCGGGTCGGGTAGG + Intergenic
1038958478 8:32492855-32492877 TCTGGTGGGGAGGGGAGGCTGGG + Intronic
1039009166 8:33074368-33074390 GCTGGTGGGGTGGAGCAGGGAGG - Intergenic
1039060759 8:33570560-33570582 GCTGGTCGGGAGGCTGAGGTGGG - Intergenic
1039589026 8:38731037-38731059 GCTCCTGGGGAGGCTCAGGTGGG - Intronic
1039952660 8:42184050-42184072 GCTGCTTGGGAGGCTCAGGTGGG - Intronic
1040981786 8:53251806-53251828 GCTGGAGGGGACGCGGGGCTGGG - Intergenic
1041810900 8:61908979-61909001 GCTGCTTGGGAGGCTGGGGTGGG + Intergenic
1042356277 8:67831361-67831383 GCTGCTCGGGAGGCGGGGGCAGG + Intergenic
1042560500 8:70069936-70069958 GCTGGTGGGGAGGCGCGGGTCGG - Intronic
1042887427 8:73567848-73567870 GCTGGGGGGGAGGGGGGAGTTGG + Intronic
1042903334 8:73748893-73748915 GGTGGTGGGGAGGGGCGGGGGGG - Intronic
1042924056 8:73948721-73948743 GCTACTGGGGAGGCTCAGGTGGG + Intronic
1042976694 8:74478105-74478127 GCTGGTGGGGTGGTGGGGGTGGG + Intronic
1044229926 8:89762074-89762096 GCTGCTGGGGAGGCTAAGGTGGG + Intronic
1044520932 8:93198549-93198571 GCAGGTGGGGAGGAGAGGGAGGG + Intergenic
1045136233 8:99221818-99221840 GCTGCTGGGGAGGCTGGGGCAGG - Intronic
1045158429 8:99506743-99506765 GCTGCTGGGGAGGCTAAGGTGGG + Intronic
1045227255 8:100261204-100261226 GCTGGTCGGGAGGCTGAGGTAGG - Intronic
1046654008 8:116874072-116874094 GCTGGTGGGGCTGGGCGGGGTGG - Intronic
1047499019 8:125428477-125428499 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
1048307154 8:133292486-133292508 GCTGGAGGGGAGGCTGGGTTGGG - Intronic
1049009708 8:139879257-139879279 GCTGGGGGTGAGGAGTGGGTGGG + Intronic
1049240659 8:141535959-141535981 GGCGGTGGGGAGGGGCGGGGAGG + Intergenic
1049499106 8:142952033-142952055 GGTGGTGGGAAGGTGAGGGTGGG + Intergenic
1049625230 8:143616959-143616981 CCTAGTGGGGAGTCGTGGGTTGG - Intronic
1049756600 8:144313729-144313751 GGAGGCGGGGAGGCGCGGGGAGG - Intronic
1049762970 8:144339144-144339166 GCTGGTGGGGGGGCGGGGCGAGG - Intergenic
1049791098 8:144473094-144473116 GCGGGTGGGCGGGCCCGGGTGGG - Exonic
1050113831 9:2242684-2242706 GCAGCTGGGGAGGTGCGGGCGGG - Intergenic
1050306717 9:4312354-4312376 GCTACTGGGGAGGCTGGGGTAGG + Intronic
1050494449 9:6226117-6226139 GCTGGTGGGGAGGCTGAGGTGGG - Intronic
1051058782 9:13021228-13021250 GCTGGTGGGGGGGGGGGGGTGGG + Intergenic
1051621070 9:19049692-19049714 GCTGATGGGGAAGAGCGGGTCGG + Exonic
1051893897 9:21969274-21969296 GCTAGTCGGGAGGCTCAGGTGGG + Intronic
1052142462 9:25004058-25004080 GCTGGTGGGGTGGGGTTGGTGGG + Intergenic
1052144255 9:25027533-25027555 GCTACTGGGGAGGCTCAGGTAGG - Intergenic
1052437015 9:28443332-28443354 GCAGGTGGGGAGGCATGGCTGGG + Intronic
1053182709 9:35987317-35987339 GCTGCTTGGGAGGCGGAGGTGGG + Intergenic
1054531251 9:66184759-66184781 GCGGGTGGCGAGGTGCAGGTAGG + Intergenic
1054777882 9:69139103-69139125 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
1055276860 9:74627048-74627070 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
1055685887 9:78774422-78774444 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
1055730581 9:79276165-79276187 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
1056299347 9:85225996-85226018 GCAGGTGGAAGGGCGCGGGTGGG - Intergenic
1056390869 9:86140498-86140520 GCTGGTGGGGAGGCTGAGGCAGG + Intergenic
1057397050 9:94689662-94689684 GCTGGTGGGAAGGCGGGAGGGGG - Intergenic
1057594232 9:96401279-96401301 GCTGATTGGGAGGCCAGGGTGGG + Intronic
1057802885 9:98200559-98200581 GGTGGTGGGGGGGCGGGGGAAGG + Intronic
1058703459 9:107619912-107619934 GCAGGTGGGGAGGAGTAGGTGGG + Intergenic
1059442477 9:114316685-114316707 GCTGGTGGTGAAGCGCAAGTTGG - Intergenic
1060069134 9:120531259-120531281 GGTGGGGGTGAGGCGGGGGTAGG - Intronic
1060412192 9:123407152-123407174 GCAGGGGGGGAGGGGCGGGGGGG + Intronic
1060521789 9:124298217-124298239 GGAGGTGGGGAGGCGCGAGGGGG - Intronic
1060821011 9:126661659-126661681 GCAGGTGGGGAGGGGTGGGCGGG - Intronic
1060977186 9:127771542-127771564 GCTGCTGGGGAAGCGAGCGTTGG - Intronic
1061177526 9:129006694-129006716 GCTGGTGGAGAGGGGTAGGTGGG - Exonic
1061373685 9:130212004-130212026 GCAGGTGGGGAGGAGGGGGAAGG + Intronic
1061382309 9:130265831-130265853 GCTGCGGTGGAGGCGCAGGTCGG - Intergenic
1061540501 9:131275778-131275800 CCTGGTGGGGGGCCGCGGATAGG - Intronic
1061895172 9:133643352-133643374 GCTGCTGGGGAGGGGAGGGTGGG + Intronic
1061937241 9:133864613-133864635 GCCTGTGGGGTGGCGGGGGTAGG - Intronic
1061956114 9:133962117-133962139 GCTGGTGGGCAGGGTGGGGTTGG - Intronic
1062230580 9:135479769-135479791 GCGGGAGGGGAGGGGCGGGGCGG - Intronic
1062425836 9:136505780-136505802 GCAGGTGGGGCTGCGCGGGCCGG + Exonic
1062483515 9:136763242-136763264 GCCTGTGAGGAGGCGCGGGGCGG + Intronic
1062489938 9:136800166-136800188 GCAGGTGGAGAGGCGGGGCTGGG + Exonic
1062562334 9:137147029-137147051 GCTGGGGGGGAGGGGCCTGTCGG - Intronic
1062579023 9:137221530-137221552 GCTGGCGAGGGGGCGCGGGGGGG + Exonic
1062644168 9:137538294-137538316 CCTGGGGTGGAGGCGTGGGTGGG - Intronic
1185734162 X:2484918-2484940 GCTGGTGGGAAGGAGCCGGTTGG - Intronic
1185860592 X:3575460-3575482 GCTGCTGGGGAGGCTGAGGTTGG - Intergenic
1185953308 X:4460397-4460419 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
1186880649 X:13862796-13862818 GCTACTGGGGAGGCTGGGGTGGG - Intronic
1187006747 X:15240041-15240063 GCAGGTGGGGGGGCGGGGGAGGG + Intronic
1187174314 X:16882647-16882669 GGTGCTGGGGAGGGGCGGGGCGG - Intergenic
1187332445 X:18353970-18353992 GCTGGCGGGGAGGCGAGGAGGGG - Intronic
1187363650 X:18649805-18649827 GCTGGAGGGGTGTCGCGGGTGGG - Intronic
1187497140 X:19804879-19804901 GCGGGTGGGGGGGGGGGGGTAGG - Intronic
1188830959 X:34896141-34896163 GCTGGTGGGGAGGTGCTGCCTGG - Intergenic
1189207826 X:39257015-39257037 GGTGGGGGGGAGGGGCGGGTTGG - Intergenic
1189496298 X:41511870-41511892 GCTACTGGGGAGGCTGGGGTGGG + Intergenic
1190231708 X:48587325-48587347 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
1190598962 X:52070142-52070164 GCTGGGGGCGAGGCGGGGGGAGG - Intergenic
1190609862 X:52183931-52183953 GCTGGGGGCGAGGCGGGGGGAGG + Intergenic
1191650143 X:63528756-63528778 GCTGGGGGGTAGGGGAGGGTGGG - Intergenic
1192179173 X:68905293-68905315 GGTGGTAGGGCGGCGGGGGTGGG - Intergenic
1192209603 X:69119414-69119436 GCAGGTGGGGCGGAGCAGGTGGG - Intergenic
1192473710 X:71420887-71420909 GCCGGTGGGGAGGCCGGGGAGGG - Intronic
1192657284 X:73004320-73004342 GCTGGTGGGTTGGCGGGGGAGGG - Exonic
1192664836 X:73078687-73078709 GCTGGTGGGTTGGCGGGGGAGGG + Exonic
1193098921 X:77585462-77585484 GCTACTGGGGAGGCGGAGGTGGG + Intronic
1195004135 X:100670016-100670038 GCAGGTTGGGAGGCGGAGGTGGG - Intronic
1195081623 X:101376727-101376749 TCTGGTGGGGGGGTGGGGGTGGG + Intronic
1195880424 X:109586903-109586925 GCAGCAGGGGAGGCACGGGTGGG - Intergenic
1197233305 X:124029953-124029975 GGGGGTGGGGACGCGCGGGTAGG - Intronic
1198256140 X:134925818-134925840 GCTGGTGGGCAGGCACTGCTGGG - Intergenic
1199622006 X:149710558-149710580 GCTGGTAGGGAGGCTAAGGTGGG - Intronic
1199760186 X:150898885-150898907 GTGGGTGGGGAGGCCTGGGTTGG + Intergenic
1200058178 X:153472404-153472426 GGTGGTGGGGTGGCGTGGGCAGG - Intronic
1200063648 X:153494857-153494879 GCTGGTGGGGCGGAGAGGGCGGG - Intronic
1200070645 X:153527372-153527394 GCTGCTGGGCAGGCCCGGGCTGG + Intronic
1200099900 X:153685186-153685208 GCTGCTGGGGAGGGGCAGGGTGG - Intronic
1201553496 Y:15243688-15243710 GCTGCTTGGGAGGCTGGGGTGGG + Intergenic