ID: 1042560870

View in Genome Browser
Species Human (GRCh38)
Location 8:70071363-70071385
Sequence GGCCAATGGCTGCGGTGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042560870_1042560879 7 Left 1042560870 8:70071363-70071385 CCCGCCCACCGCAGCCATTGGCC 0: 1
1: 0
2: 0
3: 26
4: 253
Right 1042560879 8:70071393-70071415 GACTCGCCCTCTGTCCCCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 194
1042560870_1042560878 6 Left 1042560870 8:70071363-70071385 CCCGCCCACCGCAGCCATTGGCC 0: 1
1: 0
2: 0
3: 26
4: 253
Right 1042560878 8:70071392-70071414 CGACTCGCCCTCTGTCCCCTGGG 0: 1
1: 0
2: 1
3: 30
4: 781
1042560870_1042560877 5 Left 1042560870 8:70071363-70071385 CCCGCCCACCGCAGCCATTGGCC 0: 1
1: 0
2: 0
3: 26
4: 253
Right 1042560877 8:70071391-70071413 TCGACTCGCCCTCTGTCCCCTGG 0: 1
1: 0
2: 0
3: 20
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042560870 Original CRISPR GGCCAATGGCTGCGGTGGGC GGG (reversed) Intronic
900367652 1:2317804-2317826 AGACCATGGCTGCCGTGGGCGGG + Intergenic
900589137 1:3452052-3452074 GGCCCATGGCTGGGGGGGCCGGG - Intergenic
900608274 1:3533509-3533531 GGGCTGTGGCTGCGGAGGGCGGG - Intronic
900876906 1:5349311-5349333 TGCCAGTGGCTGTGGAGGGCGGG - Intergenic
901036115 1:6337208-6337230 GGCCGAGGGCTGTGGTGGCCAGG + Intronic
901786162 1:11626220-11626242 GCCCAAGGGGTGGGGTGGGCGGG + Intergenic
902808759 1:18876459-18876481 GGCAAAGGACTGGGGTGGGCAGG + Exonic
902823376 1:18956695-18956717 GGCCAGTGTCTGCAGTGGGCGGG - Intergenic
904094318 1:27965765-27965787 GTCGAATGACTGCGGTGGACGGG + Intronic
904425020 1:30417486-30417508 GGCCCATGACTGGGGAGGGCAGG - Intergenic
905249668 1:36639823-36639845 GGCCAATGACTGATGTGAGCTGG - Intergenic
906040732 1:42786001-42786023 TGCCAATGGCTGCTCTGTGCCGG - Intronic
906091990 1:43187666-43187688 GGCCTAGGGCTGGGGTGGGGAGG - Intronic
906685501 1:47760830-47760852 CCCCAGTGGCTGGGGTGGGCAGG - Exonic
907388644 1:54141966-54141988 GGCAGAGGGCTGCTGTGGGCTGG + Intronic
907506543 1:54923175-54923197 GGGCAATGGTTGGGGTGGGGAGG - Intergenic
908133623 1:61103421-61103443 TGCTAATGGATGCTGTGGGCAGG - Intronic
916745368 1:167680964-167680986 GGCCCATGGCTGAGGTGGTATGG + Intronic
917437214 1:175033708-175033730 GGCCACTGGCTACAGTGTGCAGG + Intergenic
917581739 1:176385312-176385334 TGCCAATGTCTGCTGTGGTCTGG + Intergenic
917737959 1:177937386-177937408 GGGAAAGGGCTGCTGTGGGCTGG + Exonic
920382944 1:205546255-205546277 AGCCAAGGGCTGGGGTGGGGTGG + Intergenic
922809848 1:228409339-228409361 GGGCAGTGGCAGCGGTGGGCGGG - Intronic
923207753 1:231775379-231775401 GGCCAATGTCAGAGATGGGCTGG + Intronic
924123941 1:240830284-240830306 GGACAAAGGCTGCAGTGTGCAGG + Intronic
924229091 1:241948460-241948482 TGGCATTGGCTGCGCTGGGCTGG + Intergenic
924386914 1:243507519-243507541 GGGCAGGGGCTGCGGTGGGAGGG + Intronic
924488737 1:244513746-244513768 GGGCACTGGCAGTGGTGGGCAGG + Intronic
1062834584 10:627268-627290 GGCCCAGGGCTGCTGTGGGTCGG + Intronic
1062838246 10:650373-650395 GGCGTGTGGCTGCCGTGGGCTGG - Exonic
1067033915 10:42899001-42899023 GGCCTCTGGCTTAGGTGGGCTGG + Intergenic
1067290474 10:44935896-44935918 AGGCAATGTCTGCTGTGGGCAGG + Exonic
1067427233 10:46219607-46219629 GGCCCAAGTCTGCGGTGAGCTGG - Intergenic
1071020865 10:81053667-81053689 GGCCTGAGGCTGCGGTGGGATGG + Intergenic
1071524887 10:86352832-86352854 GGCCACTCCCTGGGGTGGGCAGG + Intronic
1072610602 10:97014965-97014987 AGCAAAGGGCTGCGGTGAGCAGG + Intronic
1073343523 10:102764310-102764332 GGCCAATGGCTGTGCTGTGATGG + Intronic
1073552323 10:104415000-104415022 GCTCAGTGACTGCGGTGGGCAGG - Intronic
1076256851 10:129033403-129033425 GCCCAATTCCTGCGATGGGCTGG - Intergenic
1076599150 10:131645903-131645925 TGCCGATGGCTCAGGTGGGCTGG - Intergenic
1076628069 10:131834080-131834102 GGCCTGGGGCTGCTGTGGGCTGG - Intergenic
1076889526 10:133276914-133276936 GCCCATTGGCTGCGGGGCGCCGG - Intergenic
1076898165 10:133324522-133324544 TGCAATTGGCTGGGGTGGGCGGG + Intronic
1076898174 10:133324555-133324577 TGCAATTGGCTGGGGTGGGCGGG + Intronic
1077064868 11:636689-636711 GGCCAGAGGCTGCGGGGGGGGGG + Intergenic
1077474002 11:2777926-2777948 GGCCAAGTGCTGGGGTGGGCCGG - Intronic
1078179986 11:9003645-9003667 AGCCAAGGGCAGCGGCGGGCCGG + Intronic
1080368621 11:31608634-31608656 GGACTCTGGTTGCGGTGGGCAGG + Intronic
1081046342 11:38278599-38278621 GCCCAATGGCTGAGGAGTGCGGG - Intergenic
1083292913 11:61699763-61699785 CACCAATGGCAGCTGTGGGCAGG + Intronic
1083554430 11:63614430-63614452 GTCTAATGGCCGCGGTGGCCGGG + Intronic
1084008693 11:66336109-66336131 GCCCAATGCCAGCGGCGGGCAGG - Exonic
1084083386 11:66843451-66843473 GCGCAATGGCGGCGCTGGGCGGG + Exonic
1089062115 11:115634111-115634133 GGCCAGCGGCTGCGGAGGGTGGG - Intergenic
1090768687 11:129899079-129899101 GGACAATGGCTGGAATGGGCTGG + Intergenic
1093583189 12:20807390-20807412 GCCCAAGGGCTGAGGAGGGCGGG - Intergenic
1100906398 12:99305055-99305077 GGCCAAGGGCGGTGGGGGGCAGG + Intronic
1101418908 12:104532817-104532839 GGCCACTGTCTGGGGTGGGGAGG - Intronic
1101534504 12:105604961-105604983 GGCCAATGACAGGGGTGGCCTGG + Intergenic
1101840320 12:108323401-108323423 GGACACAGGCTCCGGTGGGCTGG + Intronic
1102283080 12:111633910-111633932 TGTAAATGGCTGCTGTGGGCTGG + Intergenic
1103446890 12:121000528-121000550 GGCCCGTGTCTGCGGGGGGCTGG + Intronic
1103553710 12:121753290-121753312 GGCCAGGGGCTGCGGGAGGCAGG + Intronic
1103916829 12:124380179-124380201 GGTGAAGGGCTGGGGTGGGCGGG - Intronic
1103954554 12:124568861-124568883 GGGGAATGGCTGCGGTGGGGAGG + Intergenic
1104085556 12:125471247-125471269 GGCCATGGGCTGCTGTGGTCCGG + Intronic
1109335719 13:60991064-60991086 GACCAAAGGCTGGGGAGGGCAGG + Intergenic
1112734152 13:102399462-102399484 GGCCAAGGGCTGCAGTGGGAAGG - Intronic
1113537053 13:111076333-111076355 GGGCACTGGCTGTGGTAGGCAGG + Intergenic
1113566360 13:111322054-111322076 GGCCAGGTGCTGCTGTGGGCAGG - Intronic
1113695903 13:112345215-112345237 AGCCAGAGGCTGCGGAGGGCAGG - Intergenic
1114702421 14:24692742-24692764 GGGAAATGTCTGAGGTGGGCAGG + Intergenic
1116653827 14:47626869-47626891 GCCCAAGGGCTGCGGAGTGCAGG + Intronic
1119622192 14:76139375-76139397 GGGCAATGGCTGAGGCAGGCAGG + Intergenic
1119703897 14:76772427-76772449 GGCCTGTGGCTGCTGTGTGCTGG + Intronic
1121024625 14:90606263-90606285 GGCCTATGGTTGGGGTGTGCTGG + Intronic
1121045008 14:90781510-90781532 GGCCTGTGGCTGGGCTGGGCCGG + Intronic
1121122564 14:91385234-91385256 GGGCCCTGGCTGCGGTGGGCTGG - Intronic
1122939981 14:104976931-104976953 GGATGATGGCTCCGGTGGGCTGG - Intronic
1123056705 14:105574261-105574283 GGCCAAGGGCTGCGGCCGGTCGG + Intergenic
1123466188 15:20517784-20517806 GCCCCCTGGCTGCGGTTGGCTGG + Intergenic
1123651927 15:22483255-22483277 GCCCCCTGGCTGCGGTTGGCTGG - Intergenic
1123742347 15:23292115-23292137 GCCCCCTGGCTGCGGTTGGCTGG - Intergenic
1123760979 15:23432371-23432393 GCCCCCTGGCTGCGGTTGGCTGG + Intergenic
1123978377 15:25574406-25574428 GGGCAATGGCTGTGATGGGTGGG + Intergenic
1124276913 15:28333760-28333782 GCCCCCTGGCTGCGGTTGGCTGG + Intergenic
1124305787 15:28577846-28577868 GCCCCCTGGCTGCGGTTGGCTGG - Intergenic
1125926763 15:43569233-43569255 GGCCAATGGCTAGGGAAGGCTGG + Intronic
1125939907 15:43668798-43668820 GGCCAATGGCTAGGGAAGGCTGG + Intergenic
1127464507 15:59231194-59231216 GCCAGAGGGCTGCGGTGGGCAGG + Intronic
1129070470 15:72946357-72946379 GGGCAAAGGCTTCGGTGGGCAGG - Intergenic
1130256790 15:82329570-82329592 GGCCAGGGGCTGCCATGGGCTGG - Intergenic
1130598159 15:85260418-85260440 GGCCAGGGGCTGCCATGGGCTGG + Intergenic
1130989879 15:88869940-88869962 GGCTAAGGGCTGAGCTGGGCAGG - Intronic
1131493433 15:92882599-92882621 AGCCAATGGCCGCGGCGGGCGGG + Intergenic
1131996868 15:98141872-98141894 GGGCAGTGGCAGGGGTGGGCTGG - Intergenic
1132675757 16:1120679-1120701 GGCCAGGGCCTGCGGTGGGTGGG - Intergenic
1132869770 16:2110729-2110751 GGTCAATGGCTCCCTTGGGCTGG - Exonic
1133022513 16:2973107-2973129 GTCCAGGGGCTGGGGTGGGCAGG - Exonic
1134198470 16:12177795-12177817 GCCAAATGCCTGCTGTGGGCGGG + Intronic
1134717651 16:16364872-16364894 GGTCAATGGCTCCCTTGGGCTGG + Intergenic
1134957101 16:18387287-18387309 GGTCAATGGCTCCCTTGGGCTGG - Intergenic
1135048501 16:19173403-19173425 GGCCATTGGGGGAGGTGGGCGGG - Intronic
1135322598 16:21507298-21507320 GGCCGCAGGCTGCGCTGGGCGGG - Intergenic
1135541650 16:23334452-23334474 GACCAATGGCAGTGGAGGGCAGG + Intronic
1136334075 16:29600435-29600457 GGCCGCAGGCTGCGCTGGGCGGG - Intergenic
1136616905 16:31403907-31403929 GGCCTCTGGCTGCTGTGGGGTGG - Intronic
1138537215 16:57666567-57666589 TCCCAATGGCTCCAGTGGGCAGG - Intergenic
1139420159 16:66844867-66844889 GGCCCAGGGCAGCGGGGGGCGGG + Intronic
1139475234 16:67199607-67199629 GGCCAGGGCCTGCGGAGGGCGGG + Intronic
1140776199 16:78250769-78250791 GTCCAGTGGTGGCGGTGGGCTGG + Intronic
1141527005 16:84618120-84618142 GGCCAATGGGCGCGGGGGGGCGG - Intergenic
1142034843 16:87856527-87856549 GGCCACAGGCTGCACTGGGCGGG - Intronic
1142315435 16:89341813-89341835 GGGCCGTGGCTGCTGTGGGCTGG - Intronic
1142711224 17:1724962-1724984 GGCCCAGGGCAGCGGGGGGCGGG + Exonic
1143057540 17:4173539-4173561 GGCCAGTCGCTGCTGTGGCCGGG - Intronic
1144656786 17:17042293-17042315 GGCCAATGGCAGTCGGGGGCGGG - Intergenic
1144822848 17:18087758-18087780 GGCCCACGGCTGCGGCTGGCAGG - Intergenic
1144853933 17:18257958-18257980 ACCCACTGGCTGCGGAGGGCTGG + Intronic
1145242789 17:21249459-21249481 GGCCGCTGGCTGTGTTGGGCTGG - Intronic
1145255369 17:21319342-21319364 GGGCAGGGGCTGTGGTGGGCAGG + Intergenic
1145264465 17:21373044-21373066 GGCCAAGGTCTAGGGTGGGCAGG + Intergenic
1145321239 17:21768610-21768632 GGGCAGGGGCTGTGGTGGGCAGG - Intergenic
1145901822 17:28494787-28494809 GGCAAAGGGCTGGGGTGGGATGG - Intronic
1147325596 17:39668070-39668092 GGTGAATGGCTGCGGGGGGCTGG + Intronic
1147384263 17:40072284-40072306 GAGCACTGGCTGCTGTGGGCCGG - Intronic
1147869464 17:43577371-43577393 GGTGAATGGGTGGGGTGGGCTGG + Intronic
1147946578 17:44083724-44083746 GGCCAGCGGCTGTGGTAGGCAGG + Intronic
1147962558 17:44177044-44177066 TGCCAACGGCTGCGGGGGCCTGG + Exonic
1148088054 17:45006602-45006624 GGCTGATGGCTGCTTTGGGCAGG + Intergenic
1148460689 17:47837618-47837640 GCCCAAAGGCAGCTGTGGGCTGG - Exonic
1148783673 17:50135058-50135080 GGCCGAGGGCTGCCGAGGGCTGG - Exonic
1148899710 17:50866520-50866542 GGCCAATGGCGTCGGGGGGCAGG - Intronic
1150358192 17:64506122-64506144 CGTCAATGGTTGCGGTTGGCGGG + Exonic
1150625477 17:66838444-66838466 GGCCATGGGCTGCCGTGAGCAGG - Intronic
1152648555 17:81481571-81481593 GCCGATTGGCTGCGGCGGGCCGG + Intergenic
1154133565 18:11757242-11757264 AGCCAAGGGCTGCTGTGGGGAGG + Intronic
1154330036 18:13421857-13421879 GGCCTGGGGCTGGGGTGGGCAGG + Intronic
1155239176 18:23848646-23848668 GGCCTATGGCTGCTGGGGACAGG + Intronic
1155407849 18:25510015-25510037 TGCCATTGGCTGCCGTGGGAAGG + Intergenic
1156447825 18:37250095-37250117 GGCCAATCTCTGAGCTGGGCGGG + Intronic
1157324094 18:46656849-46656871 TGCAGCTGGCTGCGGTGGGCAGG - Intronic
1157801956 18:50628013-50628035 GACCAATGGGTGTGGTGGCCTGG - Intronic
1157820818 18:50767272-50767294 GGGCACAGGCTGTGGTGGGCAGG - Intergenic
1159951328 18:74486402-74486424 GGCCAGTGGCTCTGGTGGCCTGG + Intergenic
1160584071 18:79903191-79903213 GGGCAATGGCTGAGGGGGCCGGG - Exonic
1160810010 19:1009211-1009233 AGCCAACGGCTCCGGAGGGCTGG + Exonic
1160828482 19:1091612-1091634 GGCCCATGGACGCGGTGGGAGGG + Intronic
1162866850 19:13554527-13554549 GGCTAATGAATGTGGTGGGCTGG - Intronic
1163435442 19:17292545-17292567 GGCCGTTCGCTCCGGTGGGCGGG - Exonic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164609700 19:29623815-29623837 GGCCACAGGGTGCGGTGGGAGGG + Intergenic
1164644064 19:29845094-29845116 GGGCCAGGGCGGCGGTGGGCGGG + Intergenic
1166499522 19:43330537-43330559 TGCCAATGTCTGAGGTAGGCAGG + Intergenic
1167978762 19:53254961-53254983 GGCAAATGGCGGGGATGGGCGGG + Intergenic
925340188 2:3130753-3130775 GGACAAGGACTGAGGTGGGCAGG + Intergenic
926109664 2:10173809-10173831 GGCCAAGGGCTCCAGAGGGCAGG - Intronic
929983230 2:46699597-46699619 GGCCTCTGGCTGGGATGGGCTGG + Intronic
930018618 2:46987282-46987304 GGGCAATGGCTGCTGGGGCCAGG + Intronic
930046207 2:47175688-47175710 GGCCATTGGCGGGGATGGGCGGG - Intronic
931487207 2:62705665-62705687 GGCCAATGGCGGCGGGGCGGTGG + Intronic
934966894 2:98731200-98731222 GGCCAATGGCTGGCGGGGTCGGG - Intergenic
936399692 2:112155914-112155936 TGCCAAAGGCTGCGCTGGGAAGG - Intronic
937010626 2:118559837-118559859 AGCCAATGGCTGGGCAGGGCAGG + Intergenic
938239771 2:129734464-129734486 AGCCTCTGGCTGGGGTGGGCTGG + Intergenic
938693770 2:133816174-133816196 GGGTGCTGGCTGCGGTGGGCAGG - Intergenic
938753712 2:134360787-134360809 TGGCAATGGCTGCAGTTGGCTGG - Intronic
939465132 2:142546203-142546225 GGCCAGTGGCTGCGGAGGGTGGG + Intergenic
939869116 2:147507281-147507303 GCCCAATGGCTGAGGAGTGCGGG + Intergenic
942192281 2:173482129-173482151 AGTGAATGGCTGAGGTGGGCTGG + Intergenic
942745137 2:179223255-179223277 GGCCAGTGGCTGCCTAGGGCTGG + Intronic
946245975 2:218387696-218387718 GGCCGCGGGCTGCGGGGGGCTGG + Intronic
946351935 2:219160859-219160881 GGCCTATGCCTGGCGTGGGCGGG + Intronic
946360944 2:219219011-219219033 GGCCAATGGGAGCCGTGGGTAGG - Intronic
947461610 2:230308611-230308633 AGCCAGTGGCTGTGGAGGGCGGG + Intronic
948207186 2:236168464-236168486 GGCCATTGGCTGAGCGGGGCGGG + Intergenic
948449053 2:238057852-238057874 GCCCAAGGGCTGCGGAGTGCAGG - Intronic
948454130 2:238096921-238096943 GGGCACTGGGTGTGGTGGGCAGG + Intronic
948462531 2:238137258-238137280 GGACTATGGCTGAGCTGGGCTGG + Intergenic
948462559 2:238137387-238137409 GGGCAATAGCTGAGCTGGGCTGG + Intergenic
949047121 2:241877324-241877346 GCCCGATGGCAGGGGTGGGCTGG - Intergenic
1168805604 20:670639-670661 GGCAAAGGGCAGCGGGGGGCAGG - Intronic
1170064754 20:12299211-12299233 GGGCACTGGCTGTGGTGGGCAGG + Intergenic
1170416453 20:16148000-16148022 GGCTATTGGCTGGGGTGGCCAGG - Intergenic
1175332246 20:58173302-58173324 AGCCAATGGCTGCCGTGGGGCGG + Intergenic
1175894322 20:62329375-62329397 GGCCCAGGGCTGGGCTGGGCTGG - Intronic
1179557965 21:42192699-42192721 TGCAAATGCCTTCGGTGGGCAGG - Intergenic
1180099319 21:45577069-45577091 TGCCAGTGGCTGCAGTGGTCTGG + Intergenic
1180858173 22:19061205-19061227 GGAGAAAGGCTGGGGTGGGCTGG + Intronic
1180987207 22:19912003-19912025 TGCCACAGGCTGAGGTGGGCAGG + Intronic
1181016225 22:20070399-20070421 GGAAACTGGCTGTGGTGGGCAGG + Intergenic
1181107225 22:20582527-20582549 GGCCTATGCGTGCGGTGGGCAGG + Intronic
1182494194 22:30694858-30694880 GGCCAGTGGGGGCGGGGGGCAGG - Exonic
1183324829 22:37185508-37185530 TGCCGATGCCTGGGGTGGGCGGG + Intronic
1183663322 22:39233980-39234002 GGACAATGGCCGCGCTGGGCAGG + Intronic
1183935295 22:41258423-41258445 GGACCCTGGCTGTGGTGGGCAGG + Intronic
1184869489 22:47226184-47226206 GGCCAAAGGTGGCAGTGGGCTGG + Intergenic
1185030771 22:48441757-48441779 GGCTCATGGCTGAGGTGAGCAGG - Intergenic
1185059602 22:48599411-48599433 GGCCATTGGGTGCCATGGGCAGG + Intronic
949292817 3:2485273-2485295 GCCCAAGGGCTGAGGAGGGCGGG + Intronic
949970197 3:9397513-9397535 GGCCAATGGGTGCGGGGCGGTGG + Intergenic
950176665 3:10879561-10879583 GGCCATTGGCTGGGGCAGGCGGG - Intronic
950704543 3:14771797-14771819 AGCAAATGCCTGCGGTGGGGCGG - Intronic
953470711 3:43163638-43163660 AGACAATGGCTGCAGAGGGCAGG + Intergenic
954089267 3:48271937-48271959 GCCCAAGGGCTGAGGTGTGCAGG - Intronic
954582010 3:51707949-51707971 GGGCCATGGCTAGGGTGGGCAGG + Intronic
958549590 3:95595514-95595536 GCCCAAGGGCTGCGGAGTGCGGG - Intergenic
962277901 3:134029796-134029818 GCCCCATGGCTGCGGGCGGCTGG + Exonic
962325955 3:134432370-134432392 GGACGATGGCTGAGGTGGGAGGG + Intergenic
963403082 3:144826447-144826469 CGCCCATGGCTGGGGTGGCCAGG + Intergenic
963870750 3:150410643-150410665 GGGCCATGGCTTCGCTGGGCTGG - Exonic
967281475 3:187827914-187827936 TGCCATTGGCTGTGGTGAGCTGG + Intergenic
967975979 3:195035058-195035080 GGCCAAGGGCAGCGTTTGGCAGG - Intergenic
968517070 4:1019837-1019859 GGCCAAGGACTGGGATGGGCCGG + Intronic
969639705 4:8389432-8389454 GGGCAAAGGCTGGGGTGGGGAGG - Intronic
971030838 4:22635111-22635133 GCCCAATGGCTGAGGAGTGCGGG + Intergenic
973539798 4:51924538-51924560 GGCCAATGGCTTCACTGGTCAGG - Intergenic
975996448 4:80321515-80321537 GGGCAGTGGCGGTGGTGGGCGGG - Intronic
983229213 4:165112756-165112778 GGGAAATGGCGGCGGGGGGCAGG - Exonic
984219159 4:176952321-176952343 GGCCACAGGCTGGCGTGGGCAGG - Intergenic
985525511 5:399473-399495 GGCAAATGGCTGTGCTGGACAGG - Intronic
987021313 5:13874978-13875000 GGTCTATGGCTGTGGAGGGCTGG + Intronic
990880284 5:60530662-60530684 GCCCAAAGGCTGAGGTGTGCGGG + Intergenic
992151939 5:73913585-73913607 GGACAGTGACTGCGGGGGGCCGG + Intronic
993905807 5:93621519-93621541 GGCCAATGGAAGCGCTGGGCGGG + Intronic
995271788 5:110228074-110228096 TGTCAATGGCTGCGGTAGGCTGG - Intergenic
997211644 5:132080460-132080482 GGGCAAGGGATGGGGTGGGCAGG - Intergenic
997410083 5:133684305-133684327 GGTCAATGGCTGGGGAGGGAGGG + Intergenic
997568152 5:134905135-134905157 GGCCAATGGCGGCGGTGCTCGGG + Exonic
998835990 5:146203557-146203579 GCCCGAAGGCTGAGGTGGGCGGG - Exonic
1000568635 5:162882836-162882858 GCCCAAGGGCTGAGGAGGGCAGG + Intergenic
1000877617 5:166660501-166660523 GGCCAGTGGCTGCTGTTTGCTGG + Intergenic
1001877764 5:175216171-175216193 AGACAATGGCTGCGGTGCACAGG + Intergenic
1002197405 5:177508911-177508933 GGCCAAGAGCTGGGGTGGGAGGG + Intronic
1003397416 6:5765167-5765189 GGCCAATGGGAGAGCTGGGCTGG - Intronic
1004647927 6:17580829-17580851 GGCCAGTAGCTGCGACGGGCGGG - Intergenic
1006106338 6:31719146-31719168 GGCCCAGGGCTGGAGTGGGCCGG + Exonic
1006810250 6:36815846-36815868 GGCCAATGACTGCAGTGGTATGG + Intronic
1007553435 6:42746890-42746912 GGCCAATTGCTGCAGTCGGAGGG + Intergenic
1008910854 6:56731081-56731103 GGCCCAGGGCTGGGGTGTGCAGG + Intronic
1016104667 6:140148116-140148138 GCCCAATGGCTGAGGAGTGCCGG - Intergenic
1017006195 6:150029386-150029408 GGCCTGTGGCTGCTGAGGGCGGG - Intergenic
1017598348 6:156054090-156054112 GGCAAAAGGCTGCTGTGGGGTGG - Intergenic
1025089648 7:56051707-56051729 GCCCAATGGCGGCGGCGCGCGGG + Exonic
1026867352 7:73831922-73831944 GGCCACTGGCTGCTGGGGACTGG + Exonic
1028850862 7:95535809-95535831 GTCCAATGCCTGCAGAGGGCTGG - Intronic
1029568095 7:101352395-101352417 GGGCAATGGGTGTGGTGGGGCGG + Intergenic
1029732612 7:102447889-102447911 GGCCAGTGGCTGCGGGGGGTGGG - Exonic
1033237417 7:139649247-139649269 GGCGGGTGGCTGCGGGGGGCGGG + Intronic
1034677379 7:152901656-152901678 GGCCATGGGCTGGGGTGGGCAGG - Intergenic
1034873604 7:154705596-154705618 GGCCCATGGCTGGGGTGGCAGGG + Intronic
1035311859 7:157974670-157974692 GGGCAGGGGCTGGGGTGGGCAGG + Intronic
1040952941 8:52954174-52954196 GCCCAAGGGCTGAGGTGTGCAGG + Intergenic
1042560870 8:70071363-70071385 GGCCAATGGCTGCGGTGGGCGGG - Intronic
1049747898 8:144270739-144270761 AGCCAGGGGCTGTGGTGGGCAGG - Intronic
1050091061 9:2016648-2016670 GGGGAAGGGCTGCGGTGGGGAGG + Intronic
1056672951 9:88646955-88646977 GGACAGTCTCTGCGGTGGGCAGG - Intergenic
1056756863 9:89387128-89387150 GGCCTGTGGCTGGGCTGGGCTGG - Intronic
1056798578 9:89675657-89675679 GACAGATGGCTGAGGTGGGCTGG + Intergenic
1056992408 9:91423935-91423957 CGCCAATGGCCGCGGCCGGCAGG + Intergenic
1058447264 9:105065006-105065028 TGCCCATGGCTGGGGTCGGCAGG - Intergenic
1060089877 9:120733246-120733268 GTCAAATGCCTGTGGTGGGCAGG - Intergenic
1062176098 9:135163905-135163927 GGCCAATGCCTGCGGAAGGGAGG + Intergenic
1062196379 9:135276471-135276493 GCCCAGGGGCTGTGGTGGGCTGG - Intergenic
1062288572 9:135784624-135784646 TGCCCCTGGCTGCGCTGGGCTGG + Intronic
1062305869 9:135906991-135907013 GGCCTACGGCCGAGGTGGGCCGG - Exonic
1062519787 9:136952853-136952875 GGGCAGGGGCGGCGGTGGGCAGG - Intronic
1186416094 X:9384235-9384257 GTCCAATGTCTGCGGAGGGCTGG + Intergenic
1187326485 X:18295235-18295257 GGGCACTGGCTGTGGTGGGCAGG - Intronic
1187415751 X:19092112-19092134 GGCCGGTGGCTGTGGTGGGAAGG - Intronic
1187419627 X:19122765-19122787 GGCCCCCGGCTGCGGTGGGGTGG - Intergenic
1187856097 X:23637277-23637299 GGGCACAGGCTGTGGTGGGCAGG - Intergenic
1189236051 X:39488302-39488324 GCCCAAAGACTGGGGTGGGCAGG - Intergenic
1189839848 X:45063576-45063598 GGCCAAAGGCTGCCCAGGGCAGG - Exonic
1195091044 X:101459345-101459367 TGGCAATGGCTGCAGTGGGGAGG + Intronic
1196782949 X:119399440-119399462 GGCCAAAGGCTGCTGTGCGCTGG + Exonic
1197285659 X:124592683-124592705 GGCCAAGGGGAGCGGTGGGGTGG - Intronic
1200014253 X:153147000-153147022 GGCCCATGGCTGCTGTGGACTGG - Intergenic
1200025347 X:153252952-153252974 GGCCCATGGCTGCTGTGGACTGG + Intergenic
1200091508 X:153638262-153638284 GGCAAGTGGCAGCGGTGGGCAGG + Intergenic