ID: 1042560890

View in Genome Browser
Species Human (GRCh38)
Location 8:70071446-70071468
Sequence TCGCCACTAGGGTCCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042560890_1042560897 1 Left 1042560890 8:70071446-70071468 CCTCCCTGGGACCCTAGTGGCGA 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1042560897 8:70071470-70071492 CACTCGCCGCTGGCCTTCTAGGG 0: 1
1: 0
2: 0
3: 4
4: 52
1042560890_1042560896 0 Left 1042560890 8:70071446-70071468 CCTCCCTGGGACCCTAGTGGCGA 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1042560896 8:70071469-70071491 GCACTCGCCGCTGGCCTTCTAGG 0: 1
1: 0
2: 0
3: 8
4: 80
1042560890_1042560898 5 Left 1042560890 8:70071446-70071468 CCTCCCTGGGACCCTAGTGGCGA 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1042560898 8:70071474-70071496 CGCCGCTGGCCTTCTAGGGCAGG 0: 1
1: 0
2: 2
3: 7
4: 84
1042560890_1042560902 30 Left 1042560890 8:70071446-70071468 CCTCCCTGGGACCCTAGTGGCGA 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1042560902 8:70071499-70071521 GTATTGCCGCTCCAGGCGTGCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1042560890_1042560895 -9 Left 1042560890 8:70071446-70071468 CCTCCCTGGGACCCTAGTGGCGA 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1042560895 8:70071460-70071482 TAGTGGCGAGCACTCGCCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 18
1042560890_1042560901 23 Left 1042560890 8:70071446-70071468 CCTCCCTGGGACCCTAGTGGCGA 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1042560901 8:70071492-70071514 GCAGGCAGTATTGCCGCTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042560890 Original CRISPR TCGCCACTAGGGTCCCAGGG AGG (reversed) Intronic
901250001 1:7771112-7771134 GGGCCACAGGGGTCCCAGGGCGG - Intergenic
903325725 1:22567515-22567537 TGGCCCCTGGGGACCCAGGGAGG + Intronic
903632934 1:24790617-24790639 CCTCCACTAGTGTACCAGGGAGG - Intronic
904319875 1:29689771-29689793 TCCCCACCAGGGTCCCAGACTGG - Intergenic
904704798 1:32381700-32381722 TTCCCACTAGGATCACAGGGTGG + Intronic
909251485 1:73362441-73362463 TCGCCACTGGGGGCCCAAGTTGG + Intergenic
909495964 1:76279077-76279099 GGGCCACTTGGCTCCCAGGGAGG + Intronic
912304541 1:108554002-108554024 TTGCCAATAGGGACCCAGGCAGG + Intergenic
919315598 1:195967797-195967819 TTTCCATTAGGGGCCCAGGGAGG + Intergenic
920087820 1:203430662-203430684 TCCCCACTGGAGTCACAGGGAGG + Intergenic
920198151 1:204243130-204243152 TCGCCACTGCGGTGCCAGGAAGG + Intronic
1062885116 10:1010667-1010689 TCTCCACCAGAGTCTCAGGGTGG - Intronic
1063981997 10:11461456-11461478 TCCCCACGAAGGTCCCAGGGTGG - Exonic
1067843141 10:49697944-49697966 TAGCCAATAAGGCCCCAGGGAGG - Intronic
1070946421 10:80395664-80395686 TCCCCACTAGGAGCCCTGGGTGG + Intergenic
1075207165 10:120457539-120457561 CCGCGCCTAGGGTCCCAGGAAGG - Intronic
1076340145 10:129739969-129739991 TGGCCACTGGGGGCCCAGGATGG + Intronic
1076830984 10:132994081-132994103 CCGCCATCTGGGTCCCAGGGAGG + Intergenic
1077317619 11:1926358-1926380 TCGCCACTCGAGGCCGAGGGTGG - Intronic
1077331114 11:1984151-1984173 TCGCCACAGTGGTCCCAGGCGGG + Intronic
1089961566 11:122621529-122621551 TAGACACTAGGGTCCCAAGATGG - Intergenic
1090794773 11:130125249-130125271 TCTCCACTCTGGTCCCAGGGAGG + Intronic
1202814095 11_KI270721v1_random:39327-39349 TCGCCACAGTGGTCCCAGGCGGG + Intergenic
1091617602 12:2061506-2061528 TGGCCAGTAGGCTCCCAGGACGG + Intronic
1104544317 12:129697809-129697831 TATCCATTAGGGTCCAAGGGTGG - Intronic
1107656992 13:42601733-42601755 TCTCCAGTAGAGTGCCAGGGAGG - Intronic
1119418852 14:74494061-74494083 ACGCGCCTGGGGTCCCAGGGAGG - Exonic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1133156288 16:3879572-3879594 GTGCCACTAGGGTCCCCGCGAGG + Intronic
1134126887 16:11622143-11622165 TCCCCACCAGGCTGCCAGGGCGG - Intronic
1135958045 16:26972631-26972653 CCGCCTCTAGAGTCCCATGGAGG - Intergenic
1141640127 16:85336024-85336046 GAGACACTAGGGTCCCAGGAAGG - Intergenic
1141969580 16:87471931-87471953 TCACCACTAGGGTCGGAGGCCGG + Intronic
1144573529 17:16415492-16415514 TAGCCACTAAGGTCTCAGGTGGG - Intergenic
1148475792 17:47927872-47927894 TTTCCACCAGGGGCCCAGGGAGG - Exonic
1150155625 17:62850678-62850700 TCTCCTCTAGGGACCCAGGTTGG - Intergenic
1150283590 17:63943449-63943471 GGGCCACTGGGGTCCCAGGTGGG + Intronic
1151978861 17:77497650-77497672 TGGCCACTAAGGGCCCAGTGAGG + Intronic
1152649097 17:81483743-81483765 TCACCAGTAAGCTCCCAGGGAGG + Intergenic
1162907354 19:13831627-13831649 TGGGCACTAGGGTCCCAGGGTGG + Exonic
1163366725 19:16879686-16879708 TGGCCGCGTGGGTCCCAGGGTGG - Exonic
1163760983 19:19136816-19136838 TCTGCACTAGGGTCCCGGGGAGG - Intronic
1167385006 19:49157935-49157957 TCGCCTCCAGGCTCCCAGAGAGG + Intronic
927811001 2:26180093-26180115 TTCCCAGGAGGGTCCCAGGGCGG + Intronic
927839703 2:26432020-26432042 TCCTCACTAGGGTGCCTGGGTGG + Intronic
930620727 2:53640920-53640942 TGGCAAATAGGGTACCAGGGCGG - Intronic
948421479 2:237863122-237863144 CCTCCACTGGGGACCCAGGGAGG + Intronic
1169132473 20:3173323-3173345 CCGCTGCTAGGGTCCCAAGGGGG - Intronic
1175187648 20:57189841-57189863 TCGCCAGTCAGCTCCCAGGGTGG - Intronic
1175609554 20:60339402-60339424 TCTCCCCTAGGATCCCCGGGAGG - Intergenic
1181734111 22:24868513-24868535 CCGCCACTGTGGTCCCAGAGGGG + Exonic
1182484270 22:30630014-30630036 TCGGCACTGGGGTCCAAGGTGGG - Intergenic
1183479656 22:38056617-38056639 GCCCCCCTGGGGTCCCAGGGAGG - Intronic
1183507741 22:38218899-38218921 TGGCCCTGAGGGTCCCAGGGTGG + Intergenic
1185412165 22:50688500-50688522 TGCCCACTGGGGTCCCAGAGTGG + Intergenic
953636684 3:44670551-44670573 TCACCACTCAGGTCCCAAGGGGG + Intergenic
954468745 3:50674467-50674489 TCGCCACGAGGGAACCAGGTGGG - Intergenic
955656593 3:61251134-61251156 GCCCCACGAGGGTCTCAGGGTGG - Intronic
962157513 3:132963903-132963925 TGGCCAGAAGGGTGCCAGGGAGG + Intergenic
963091659 3:141487786-141487808 TAGCCACTCGGGCCCCAGGGCGG - Intronic
967105443 3:186251666-186251688 TAGACACTAGGGACCCAGAGGGG + Intronic
969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG + Intergenic
972793925 4:42398035-42398057 TCGCCACTGGGCTCCCTGGGCGG - Exonic
984259376 4:177426610-177426632 TCCCTACTAGGGTCCCAGTGGGG + Intergenic
993503080 5:88683716-88683738 TCACCACTAGGGTGCCGAGGTGG + Intergenic
1004495760 6:16161051-16161073 TGGCCACCAGGGTCTCATGGGGG + Intergenic
1035565352 8:637293-637315 AGGCCACTGAGGTCCCAGGGTGG - Intronic
1037226749 8:16602041-16602063 TGCCCACTAGGGTCTCTGGGTGG - Intergenic
1038022715 8:23563577-23563599 TGGGCCCCAGGGTCCCAGGGAGG - Intronic
1042560890 8:70071446-70071468 TCGCCACTAGGGTCCCAGGGAGG - Intronic
1046732150 8:117737324-117737346 CTGCCACTTGGGACCCAGGGCGG + Intergenic
1048572408 8:135666954-135666976 CCTCCACTAGGTTCCCTGGGTGG + Intergenic
1050585186 9:7103531-7103553 TCACCACTAGGGCCCCTGGAGGG + Intergenic
1052095213 9:24375359-24375381 CAGCCACATGGGTCCCAGGGAGG - Intergenic
1058935484 9:109766015-109766037 TCCTCACTAATGTCCCAGGGAGG + Intronic
1060894793 9:127210712-127210734 CCGCCAGTTGGGCCCCAGGGTGG - Intronic
1060944224 9:127560459-127560481 TTGTCCTTAGGGTCCCAGGGAGG - Intronic
1061194874 9:129102244-129102266 TCTCCATTGGGGGCCCAGGGAGG - Intronic
1186940459 X:14501303-14501325 TGGCCAGTTGGGTCCCAGGTGGG + Intergenic