ID: 1042563337

View in Genome Browser
Species Human (GRCh38)
Location 8:70090113-70090135
Sequence ATTCCTCAGCAGAGGTCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042563337_1042563344 4 Left 1042563337 8:70090113-70090135 CCCGAGGACCTCTGCTGAGGAAT No data
Right 1042563344 8:70090140-70090162 CCAGGGAATTGTTTGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042563337 Original CRISPR ATTCCTCAGCAGAGGTCCTC GGG (reversed) Intergenic
No off target data available for this crispr